Incidental Mutation 'R5648:Vmn1r78'
ID441267
Institutional Source Beutler Lab
Gene Symbol Vmn1r78
Ensembl Gene ENSMUSG00000061602
Gene Namevomeronasal 1 receptor 78
SynonymsV1rg7
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12150257-12159959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12152766 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 101 (M101I)
Ref Sequence ENSEMBL: ENSMUSP00000154797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078039] [ENSMUST00000228244] [ENSMUST00000228664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078039
AA Change: M101I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077186
Gene: ENSMUSG00000061602
AA Change: M101I

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 5.7e-8 PFAM
Pfam:V1R 12 301 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209489
Predicted Effect possibly damaging
Transcript: ENSMUST00000228244
AA Change: M101I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228664
AA Change: M101I

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Vmn1r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Vmn1r78 APN 7 12153238 missense probably benign 0.10
IGL02019:Vmn1r78 APN 7 12152707 missense probably damaging 0.99
IGL02143:Vmn1r78 APN 7 12152480 missense probably benign
IGL02154:Vmn1r78 APN 7 12152545 missense probably benign 0.22
IGL02290:Vmn1r78 APN 7 12153155 missense probably damaging 1.00
IGL03012:Vmn1r78 APN 7 12153364 missense probably benign 0.32
IGL03256:Vmn1r78 APN 7 12152798 missense probably damaging 1.00
IGL03373:Vmn1r78 APN 7 12153343 missense possibly damaging 0.86
IGL03384:Vmn1r78 APN 7 12153209 missense possibly damaging 0.94
R0016:Vmn1r78 UTSW 7 12153352 missense probably benign 0.02
R1445:Vmn1r78 UTSW 7 12152581 missense possibly damaging 0.64
R1748:Vmn1r78 UTSW 7 12153323 missense probably damaging 1.00
R2017:Vmn1r78 UTSW 7 12153343 missense possibly damaging 0.86
R2032:Vmn1r78 UTSW 7 12153283 missense probably benign 0.00
R2198:Vmn1r78 UTSW 7 12152560 missense probably benign 0.06
R4330:Vmn1r78 UTSW 7 12152459 splice site probably null
R4564:Vmn1r78 UTSW 7 12152558 missense probably damaging 1.00
R4769:Vmn1r78 UTSW 7 12152798 missense probably damaging 1.00
R4801:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4802:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R6561:Vmn1r78 UTSW 7 12152899 missense probably damaging 1.00
R6869:Vmn1r78 UTSW 7 12152749 missense probably benign 0.01
R6945:Vmn1r78 UTSW 7 12152905 missense probably benign 0.01
R7793:Vmn1r78 UTSW 7 12153314 missense probably benign 0.01
R7954:Vmn1r78 UTSW 7 12153300 nonsense probably null
Z1088:Vmn1r78 UTSW 7 12152714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGAATCCTTGGTAATTCC -3'
(R):5'- TGTTATAACTGGGTCCTAACACTC -3'

Sequencing Primer
(F):5'- GGGAATCCTTGGTAATTCCTCAATAC -3'
(R):5'- ACACTCTTGCTGGAGTCAAG -3'
Posted On2016-11-08