Incidental Mutation 'R5648:Klk8'
ID441268
Institutional Source Beutler Lab
Gene Symbol Klk8
Ensembl Gene ENSMUSG00000064023
Gene Namekallikrein related-peptidase 8
SynonymsBSP1, Nrpn, Prss19
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43797577-43803826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43798644 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000145580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005891] [ENSMUST00000085461] [ENSMUST00000205537]
Predicted Effect probably benign
Transcript: ENSMUST00000005891
SMART Domains Protein: ENSMUSP00000005891
Gene: ENSMUSG00000047884

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 22 244 1.66e-89 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085461
AA Change: S31P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082588
Gene: ENSMUSG00000064023
AA Change: S31P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 32 252 8.87e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205527
Predicted Effect possibly damaging
Transcript: ENSMUST00000205537
AA Change: S31P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206465
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein exhibit impaired long-term potentiation and increased anxiety, as well as a hyperkeratosis phenotype. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show aberrant synapses and neurons in the hippocampus CA1 field. Homozygotes for another null allele have normal LTP and spatial reference memory but show increased polyspiking in response to repetitive afferent stimulation and enhanced kainite-induced seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Klk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Klk8 APN 7 43803689 missense probably benign 0.14
R0783:Klk8 UTSW 7 43802197 missense probably damaging 1.00
R1733:Klk8 UTSW 7 43802121 missense possibly damaging 0.94
R2020:Klk8 UTSW 7 43799216 missense probably benign
R4036:Klk8 UTSW 7 43798087 missense probably null 0.00
R6237:Klk8 UTSW 7 43798670 nonsense probably null
R7609:Klk8 UTSW 7 43802179 missense probably damaging 1.00
R7871:Klk8 UTSW 7 43799326 splice site probably null
Z1176:Klk8 UTSW 7 43803725 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTCAGTGAACTTACATGTGGCC -3'
(R):5'- CTTCCTCAAACAGAGCCCTG -3'

Sequencing Primer
(F):5'- GCCATGTTCCAATGGATGC -3'
(R):5'- ACAGAGCCCTGAGCCTCTTC -3'
Posted On2016-11-08