Incidental Mutation 'R5648:Ubqln3'
ID 441271
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 043169-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5648 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103790117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 658 (S658P)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: S658P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: S658P

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,326,510 (GRCm39) probably null Het
Alpk2 A G 18: 65,482,988 (GRCm39) V340A probably damaging Het
Cald1 G T 6: 34,739,267 (GRCm39) probably null Het
Col24a1 C T 3: 145,064,321 (GRCm39) T702I probably benign Het
Ddx50 T C 10: 62,452,049 (GRCm39) R725G unknown Het
Dnah9 A T 11: 65,818,581 (GRCm39) F68L probably benign Het
Dnmt3b G A 2: 153,519,118 (GRCm39) V651M probably damaging Het
Dock1 G A 7: 134,348,683 (GRCm39) C299Y probably damaging Het
Epha4 T C 1: 77,375,162 (GRCm39) I562V probably benign Het
Esco2 A T 14: 66,068,641 (GRCm39) V223D probably damaging Het
Ggt6 T C 11: 72,326,542 (GRCm39) I33T possibly damaging Het
Gm10392 A T 11: 77,408,306 (GRCm39) D104E probably benign Het
Gm9847 A G 12: 14,545,130 (GRCm39) noncoding transcript Het
Gnao1 A T 8: 94,676,070 (GRCm39) Y116F probably damaging Het
Gvin1 A T 7: 105,762,606 (GRCm39) I621K possibly damaging Het
Hyal6 T C 6: 24,734,235 (GRCm39) M56T possibly damaging Het
Hyou1 T A 9: 44,296,546 (GRCm39) D490E probably damaging Het
Igsf10 G C 3: 59,235,574 (GRCm39) Q1536E probably benign Het
Klk1b8 T C 7: 43,448,068 (GRCm39) S31P possibly damaging Het
Map3k6 A C 4: 132,970,646 (GRCm39) I178L probably benign Het
Mycbp2 T A 14: 103,528,778 (GRCm39) N427Y probably damaging Het
Ncr1 T A 7: 4,347,519 (GRCm39) I228N probably damaging Het
Nefh A T 11: 4,895,233 (GRCm39) Y319N probably damaging Het
Or4a80 A C 2: 89,582,417 (GRCm39) C252G probably damaging Het
Pakap T C 4: 57,854,848 (GRCm39) V120A probably damaging Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Pkhd1 T A 1: 20,628,850 (GRCm39) Y699F probably benign Het
Plekhd1 T C 12: 80,767,362 (GRCm39) L250P probably damaging Het
Reln A G 5: 22,203,570 (GRCm39) V1228A probably benign Het
Rhobtb2 G T 14: 70,034,593 (GRCm39) R211S probably damaging Het
Rps6kb1 T C 11: 86,403,697 (GRCm39) I305V possibly damaging Het
Slc12a2 G A 18: 58,029,382 (GRCm39) G256E possibly damaging Het
Slc4a1ap A G 5: 31,708,129 (GRCm39) probably null Het
Thoc1 A G 18: 9,962,390 (GRCm39) T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,577,629 (GRCm39) probably null Het
Tmem117 T G 15: 94,992,653 (GRCm39) S438A possibly damaging Het
Ttll7 A G 3: 146,667,465 (GRCm39) N777S probably damaging Het
Ubd T A 17: 37,506,345 (GRCm39) V77E probably damaging Het
Vmn1r78 G A 7: 11,886,693 (GRCm39) M101I possibly damaging Het
Wdr93 T C 7: 79,426,974 (GRCm39) C638R probably benign Het
Zfp983 T A 17: 21,877,947 (GRCm39) V50D probably damaging Het
Zhx3 A T 2: 160,623,881 (GRCm39) H95Q probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCCAGGTAAAAGAGTGTCAG -3'
(R):5'- TCCAGGTGTTACAAGCCTTAGC -3'

Sequencing Primer
(F):5'- TGTCAGGCACAGTTGGATTACAC -3'
(R):5'- GCCTTAGCTAGTACCAATCCC -3'
Posted On 2016-11-08