Incidental Mutation 'R5648:Ddx50'
ID441276
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62616270 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 725 (R725G)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect unknown
Transcript: ENSMUST00000020270
AA Change: R725G
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: R725G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218304
AA Change: R124G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2005:Ddx50 UTSW 10 62640464 missense probably benign 0.10
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62639944 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4917:Ddx50 UTSW 10 62627671 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62640861 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 unclassified probably null
R6244:Ddx50 UTSW 10 62621566 unclassified probably null
R8098:Ddx50 UTSW 10 62625143 critical splice donor site probably null
R8163:Ddx50 UTSW 10 62639899 missense possibly damaging 0.93
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAACTTGACTGTCACATCTTAG -3'
(R):5'- CTCTCAGTGCCAGCCAAATTAC -3'

Sequencing Primer
(F):5'- TCAAAGGTATAGCCAGATAAG -3'
(R):5'- GTGCCAGCCAAATTACCTGAAATTG -3'
Posted On2016-11-08