Incidental Mutation 'R5648:Tmem117'
ID441290
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Nametransmembrane protein 117
Synonyms
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location94629232-95096098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95094772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 438 (S438A)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141] [ENSMUST00000229933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080141
AA Change: S438A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: S438A

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189291
Predicted Effect probably benign
Transcript: ENSMUST00000229933
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 95094664 missense probably benign
IGL02342:Tmem117 APN 15 95011450 missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94931884 missense probably benign 0.10
IGL02651:Tmem117 APN 15 95094561 missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94714982 missense probably benign 0.00
IGL02819:Tmem117 APN 15 94879372 splice site probably benign
IGL02881:Tmem117 APN 15 94879425 missense probably damaging 1.00
IGL02887:Tmem117 APN 15 95094775 missense probably damaging 1.00
IGL03371:Tmem117 APN 15 95011393 missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94714919 missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94714912 missense possibly damaging 0.63
R1029:Tmem117 UTSW 15 95011336 missense probably benign
R1424:Tmem117 UTSW 15 94931808 missense probably benign 0.35
R1439:Tmem117 UTSW 15 95094597 missense probably benign
R1498:Tmem117 UTSW 15 94638361 missense probably damaging 1.00
R1604:Tmem117 UTSW 15 95094544 missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94931833 missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 95094551 missense probably damaging 1.00
R3434:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R3435:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R4560:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4561:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4562:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4563:Tmem117 UTSW 15 94638154 missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 95094450 nonsense probably null
R4854:Tmem117 UTSW 15 95094688 missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94714913 missense probably damaging 0.96
R5472:Tmem117 UTSW 15 95094513 missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 95094830 missense probably benign 0.00
R5488:Tmem117 UTSW 15 95094817 frame shift probably null
R5595:Tmem117 UTSW 15 95094884 missense probably damaging 0.99
R5892:Tmem117 UTSW 15 94638139 missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94714958 missense probably benign 0.08
R6334:Tmem117 UTSW 15 95011443 missense probably benign 0.01
R7216:Tmem117 UTSW 15 94714912 missense possibly damaging 0.91
R7266:Tmem117 UTSW 15 94931803 missense possibly damaging 0.82
R7414:Tmem117 UTSW 15 94714895 missense probably damaging 1.00
R7445:Tmem117 UTSW 15 94714918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGTGACATGTTCTTACACAGCAGG -3'
(R):5'- TCATCCTTTGAGAGGCTGCC -3'

Sequencing Primer
(F):5'- TCTTACACAGCAGGTTCATAGGG -3'
(R):5'- TCACTGGTAGATTCCTTCAGATG -3'
Posted On2016-11-08