Incidental Mutation 'R5648:Ubd'
ID 441292
Institutional Source Beutler Lab
Gene Symbol Ubd
Ensembl Gene ENSMUSG00000035186
Gene Name ubiquitin D
Synonyms FAT10, Diubiquitin
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5648 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37193892-37196095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37195454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 77 (V77E)
Ref Sequence ENSEMBL: ENSMUSP00000035808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038844] [ENSMUST00000055324] [ENSMUST00000222190]
AlphaFold P63072
Predicted Effect probably damaging
Transcript: ENSMUST00000038844
AA Change: V77E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035808
Gene: ENSMUSG00000035186
AA Change: V77E

DomainStartEndE-ValueType
UBQ 5 76 8.61e-9 SMART
UBQ 88 158 9.23e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055324
SMART Domains Protein: ENSMUSP00000055232
Gene: ENSMUSG00000043827

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:7tm_4 105 382 6.5e-39 PFAM
Pfam:7TM_GPCR_Srsx 109 220 2.1e-9 PFAM
Pfam:7tm_1 115 365 3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208837
Predicted Effect probably benign
Transcript: ENSMUST00000222190
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hompzygous for disruptions in this gene show an increased susceptibility to low doses of endotoxin and increased apoptosis among lymphocytes but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Ubd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Ubd APN 17 37195682 missense probably damaging 1.00
IGL02668:Ubd APN 17 37195529 missense probably benign 0.07
IGL02725:Ubd APN 17 37193962 missense probably benign 0.14
PIT4696001:Ubd UTSW 17 37195444 missense probably damaging 1.00
R1163:Ubd UTSW 17 37195321 missense probably damaging 0.99
R4731:Ubd UTSW 17 37195702 missense probably benign 0.05
R4732:Ubd UTSW 17 37195702 missense probably benign 0.05
R4733:Ubd UTSW 17 37195702 missense probably benign 0.05
R6332:Ubd UTSW 17 37195501 missense probably benign 0.01
R6346:Ubd UTSW 17 37195351 nonsense probably null
R7687:Ubd UTSW 17 37193974 critical splice donor site probably null
R8395:Ubd UTSW 17 37195358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCTTAGATGACGCTCTTGG -3'
(R):5'- CGTTGCAATTCACAACCTGC -3'

Sequencing Primer
(F):5'- GCGGTTAATGACCTTTGAGACCAC -3'
(R):5'- CTTCTTAGGGATCACAGAGGTCAC -3'
Posted On 2016-11-08