Incidental Mutation 'R5648:Pcdhb18'
ID441295
Institutional Source Beutler Lab
Gene Symbol Pcdhb18
Ensembl Gene ENSMUSG00000048347
Gene Nameprotocadherin beta 18
SynonymsPcdhbR, Pcdhb9
MMRRC Submission 043169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5648 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37489465-37494505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37490484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 289 (R289Q)
Ref Sequence ENSEMBL: ENSMUSP00000052113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053856
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
AA Change: R289Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347
AA Change: R289Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,436,498 probably null Het
Akap2 T C 4: 57,854,848 V120A probably damaging Het
Alpk2 A G 18: 65,349,917 V340A probably damaging Het
Cald1 G T 6: 34,762,332 probably null Het
Col24a1 C T 3: 145,358,566 T702I probably benign Het
Ddx50 T C 10: 62,616,270 R725G unknown Het
Dnah9 A T 11: 65,927,755 F68L probably benign Het
Dnmt3b G A 2: 153,677,198 V651M probably damaging Het
Dock1 G A 7: 134,746,954 C299Y probably damaging Het
Epha4 T C 1: 77,398,525 I562V probably benign Het
Esco2 A T 14: 65,831,192 V223D probably damaging Het
Ggt6 T C 11: 72,435,716 I33T possibly damaging Het
Gm10392 A T 11: 77,517,480 D104E probably benign Het
Gm9847 A G 12: 14,495,129 noncoding transcript Het
Gnao1 A T 8: 93,949,442 Y116F probably damaging Het
Gvin1 A T 7: 106,163,399 I621K possibly damaging Het
Hyal6 T C 6: 24,734,236 M56T possibly damaging Het
Hyou1 T A 9: 44,385,249 D490E probably damaging Het
Igsf10 G C 3: 59,328,153 Q1536E probably benign Het
Klk8 T C 7: 43,798,644 S31P possibly damaging Het
Map3k6 A C 4: 133,243,335 I178L probably benign Het
Mycbp2 T A 14: 103,291,342 N427Y probably damaging Het
Ncr1 T A 7: 4,344,520 I228N probably damaging Het
Nefh A T 11: 4,945,233 Y319N probably damaging Het
Olfr1253 A C 2: 89,752,073 C252G probably damaging Het
Pkhd1 T A 1: 20,558,626 Y699F probably benign Het
Plekhd1 T C 12: 80,720,588 L250P probably damaging Het
Reln A G 5: 21,998,572 V1228A probably benign Het
Rhobtb2 G T 14: 69,797,144 R211S probably damaging Het
Rps6kb1 T C 11: 86,512,871 I305V possibly damaging Het
Slc12a2 G A 18: 57,896,310 G256E possibly damaging Het
Slc4a1ap A G 5: 31,550,785 probably null Het
Thoc1 A G 18: 9,962,390 T92A possibly damaging Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tmem117 T G 15: 95,094,772 S438A possibly damaging Het
Ttll7 A G 3: 146,961,710 N777S probably damaging Het
Ubd T A 17: 37,195,454 V77E probably damaging Het
Ubqln3 A G 7: 104,140,910 S658P probably damaging Het
Vmn1r78 G A 7: 12,152,766 M101I possibly damaging Het
Wdr93 T C 7: 79,777,226 C638R probably benign Het
Zfp983 T A 17: 21,659,031 V50D probably damaging Het
Zhx3 A T 2: 160,781,961 H95Q probably damaging Het
Other mutations in Pcdhb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Pcdhb18 APN 18 37491931 missense probably benign 0.35
IGL02651:Pcdhb18 APN 18 37491181 nonsense probably null
IGL02721:Pcdhb18 APN 18 37490031 missense probably benign 0.33
IGL02945:Pcdhb18 APN 18 37489995 missense probably benign 0.34
IGL03030:Pcdhb18 APN 18 37490733 missense probably damaging 1.00
IGL03346:Pcdhb18 APN 18 37489621 start codon destroyed probably null 0.99
R0206:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0208:Pcdhb18 UTSW 18 37490187 missense possibly damaging 0.80
R0680:Pcdhb18 UTSW 18 37490294 missense probably damaging 0.98
R1517:Pcdhb18 UTSW 18 37489620 start codon destroyed probably null 1.00
R1519:Pcdhb18 UTSW 18 37490892 missense probably damaging 1.00
R1597:Pcdhb18 UTSW 18 37491767 missense probably benign 0.19
R1735:Pcdhb18 UTSW 18 37490769 missense probably benign 0.00
R2089:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2091:Pcdhb18 UTSW 18 37490600 missense probably damaging 0.99
R2206:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R2207:Pcdhb18 UTSW 18 37491289 missense probably damaging 0.99
R4773:Pcdhb18 UTSW 18 37490454 missense probably damaging 1.00
R4837:Pcdhb18 UTSW 18 37489814 missense probably damaging 1.00
R5271:Pcdhb18 UTSW 18 37491596 missense possibly damaging 0.94
R5568:Pcdhb18 UTSW 18 37491800 missense probably benign 0.44
R5647:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5690:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5692:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5812:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5813:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5928:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5929:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R5930:Pcdhb18 UTSW 18 37491935 missense possibly damaging 0.63
R6209:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6255:Pcdhb18 UTSW 18 37490484 missense probably benign 0.05
R6602:Pcdhb18 UTSW 18 37490480 missense probably damaging 0.99
R6699:Pcdhb18 UTSW 18 37491952 missense probably benign 0.00
R7055:Pcdhb18 UTSW 18 37490811 missense possibly damaging 0.64
R7197:Pcdhb18 UTSW 18 37490383 missense probably benign 0.06
R7289:Pcdhb18 UTSW 18 37490647 missense probably damaging 1.00
R7345:Pcdhb18 UTSW 18 37491923 missense probably benign 0.19
R7403:Pcdhb18 UTSW 18 37491897 missense probably benign 0.09
R7541:Pcdhb18 UTSW 18 37491609 missense probably damaging 1.00
R7651:Pcdhb18 UTSW 18 37490993 missense probably benign 0.00
R7670:Pcdhb18 UTSW 18 37491696 missense probably damaging 1.00
R7673:Pcdhb18 UTSW 18 37491737 missense probably benign 0.39
X0022:Pcdhb18 UTSW 18 37490273 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTCACTGCACTTGATGGTG -3'
(R):5'- TCAGGGGCGTTGTCATTAAC -3'

Sequencing Primer
(F):5'- GGGACAGCCACTATACATATTCTGG -3'
(R):5'- CGTTGTCATTAACGTCTAAAACCCG -3'
Posted On2016-11-08