Incidental Mutation 'R5649:Kif28'
ID441301
Institutional Source Beutler Lab
Gene Symbol Kif28
Ensembl Gene ENSMUSG00000087236
Gene Namekinesin family member 28
SynonymsLOC383592, Gm1305
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179695297-179745271 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 179697771 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000211943] [ENSMUST00000221136] [ENSMUST00000223392]
Predicted Effect probably null
Transcript: ENSMUST00000131716
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131716
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211943
Predicted Effect probably null
Transcript: ENSMUST00000211943
Predicted Effect probably null
Transcript: ENSMUST00000221136
Predicted Effect probably benign
Transcript: ENSMUST00000223392
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Kif28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Kif28 APN 1 179702516 missense probably damaging 1.00
IGL00581:Kif28 APN 1 179739957 missense probably benign 0.14
R0348:Kif28 UTSW 1 179731253 missense probably damaging 1.00
R0388:Kif28 UTSW 1 179740089 missense possibly damaging 0.71
R0412:Kif28 UTSW 1 179702526 missense probably benign 0.01
R0788:Kif28 UTSW 1 179705223 unclassified probably benign
R0960:Kif28 UTSW 1 179695805 nonsense probably null
R1365:Kif28 UTSW 1 179739987 nonsense probably null
R1420:Kif28 UTSW 1 179702397 missense probably damaging 1.00
R1442:Kif28 UTSW 1 179705132 missense possibly damaging 0.73
R1507:Kif28 UTSW 1 179736006 missense probably damaging 1.00
R1818:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1819:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1903:Kif28 UTSW 1 179702523 missense possibly damaging 0.63
R2221:Kif28 UTSW 1 179733111 missense possibly damaging 0.80
R2358:Kif28 UTSW 1 179709459 missense probably damaging 1.00
R4916:Kif28 UTSW 1 179702520 missense probably benign 0.09
R4943:Kif28 UTSW 1 179713951 missense probably benign 0.02
R4967:Kif28 UTSW 1 179708442 missense probably damaging 1.00
R4974:Kif28 UTSW 1 179698644 missense probably damaging 0.98
R5152:Kif28 UTSW 1 179702538 missense probably damaging 1.00
R5382:Kif28 UTSW 1 179700282 missense probably damaging 1.00
R5999:Kif28 UTSW 1 179695790 missense probably damaging 1.00
R6017:Kif28 UTSW 1 179699453 missense probably benign 0.24
R6180:Kif28 UTSW 1 179697772 splice site probably null
R6875:Kif28 UTSW 1 179735994 missense probably damaging 0.98
R7400:Kif28 UTSW 1 179700274 missense probably damaging 1.00
R7402:Kif28 UTSW 1 179740079 missense probably benign 0.00
R7530:Kif28 UTSW 1 179708480 missense probably benign 0.31
R7589:Kif28 UTSW 1 179731400 missense probably benign 0.01
R7648:Kif28 UTSW 1 179709424 missense possibly damaging 0.89
R7815:Kif28 UTSW 1 179735983 missense probably damaging 1.00
R8030:Kif28 UTSW 1 179699064 missense probably benign 0.04
R8050:Kif28 UTSW 1 179709449 missense probably benign 0.00
R8088:Kif28 UTSW 1 179700354 missense probably damaging 1.00
Z1176:Kif28 UTSW 1 179733134 missense probably benign 0.05
Z1177:Kif28 UTSW 1 179728219 missense not run
Predicted Primers PCR Primer
(F):5'- CCCAGTTTGCCAAGAGTTTG -3'
(R):5'- GCACAGAAATGTGTGGATGCTG -3'

Sequencing Primer
(F):5'- AGACAAGGTTTCTCAGTGTAGCCC -3'
(R):5'- TATTTTACTCCAGCCCAGAAGC -3'
Posted On2016-11-08