Incidental Mutation 'R5649:Col5a1'
ID441302
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Namecollagen, type V, alpha 1
Synonyms
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27886425-28039514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27951456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 363 (D363G)
Ref Sequence ENSEMBL: ENSMUSP00000028280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280]
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: D363G
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: D363G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27971444 splice site probably benign
IGL01340:Col5a1 APN 2 27960451 missense unknown
IGL01938:Col5a1 APN 2 27996873 missense unknown
IGL02167:Col5a1 APN 2 28018556 missense probably benign
IGL02670:Col5a1 APN 2 27974715 missense unknown
IGL02672:Col5a1 APN 2 27974715 missense unknown
IGL02673:Col5a1 APN 2 27974715 missense unknown
IGL02832:Col5a1 APN 2 27952340 missense unknown
IGL03065:Col5a1 APN 2 28032745 missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27975598 missense unknown
PIT4131001:Col5a1 UTSW 2 28024653 missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 28024776 missense unknown
R0136:Col5a1 UTSW 2 28024831 missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27990097 splice site probably benign
R0626:Col5a1 UTSW 2 27928243 nonsense probably null
R0666:Col5a1 UTSW 2 28032685 missense probably damaging 1.00
R1268:Col5a1 UTSW 2 28002489 missense unknown
R1302:Col5a1 UTSW 2 28005236 missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27922064 missense unknown
R1466:Col5a1 UTSW 2 28003846 splice site probably benign
R1617:Col5a1 UTSW 2 27952381 missense unknown
R1650:Col5a1 UTSW 2 27922159 missense unknown
R1663:Col5a1 UTSW 2 27951476 missense unknown
R1901:Col5a1 UTSW 2 27960444 missense unknown
R1970:Col5a1 UTSW 2 27986754 missense unknown
R2377:Col5a1 UTSW 2 27928177 missense unknown
R2396:Col5a1 UTSW 2 27986729 missense unknown
R4297:Col5a1 UTSW 2 28017204 critical splice donor site probably null
R4385:Col5a1 UTSW 2 28024779 missense probably damaging 1.00
R4803:Col5a1 UTSW 2 28011341 missense unknown
R4835:Col5a1 UTSW 2 28025644 missense probably damaging 1.00
R4935:Col5a1 UTSW 2 28024742 missense probably damaging 1.00
R4994:Col5a1 UTSW 2 28032739 missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 28032782 nonsense probably null
R5061:Col5a1 UTSW 2 27952378 missense unknown
R5088:Col5a1 UTSW 2 28018602 nonsense probably null
R5089:Col5a1 UTSW 2 28018602 nonsense probably null
R5090:Col5a1 UTSW 2 28018602 nonsense probably null
R5114:Col5a1 UTSW 2 28025652 missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27960445 missense unknown
R5699:Col5a1 UTSW 2 27997599 missense unknown
R5910:Col5a1 UTSW 2 28036888 missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 28014377 unclassified probably benign
R6210:Col5a1 UTSW 2 28032621 missense probably benign 0.04
R6363:Col5a1 UTSW 2 27928195 missense unknown
R6478:Col5a1 UTSW 2 27952436 missense unknown
R6600:Col5a1 UTSW 2 27997571 missense unknown
R7047:Col5a1 UTSW 2 27928084 missense unknown
R7061:Col5a1 UTSW 2 28025678 nonsense probably null
R7131:Col5a1 UTSW 2 27929486 missense unknown
R7202:Col5a1 UTSW 2 27952378 missense unknown
R7270:Col5a1 UTSW 2 27997585 missense unknown
R7385:Col5a1 UTSW 2 28024750 missense unknown
R7492:Col5a1 UTSW 2 27969800 critical splice donor site probably null
R7570:Col5a1 UTSW 2 27951383 missense unknown
R7627:Col5a1 UTSW 2 27950653 nonsense probably null
R8003:Col5a1 UTSW 2 27958328 intron probably benign
R8011:Col5a1 UTSW 2 27980521 splice site probably benign
R8073:Col5a1 UTSW 2 27962129 missense possibly damaging 0.85
R8217:Col5a1 UTSW 2 27922123 missense unknown
Z1176:Col5a1 UTSW 2 28002517 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTACACTCTGCCCACAGG -3'
(R):5'- TCAACCCTGCTACTGAGGAC -3'

Sequencing Primer
(F):5'- TCTGCCCACAGGAGCAGAC -3'
(R):5'- TGCTACTGAGGACTCGGG -3'
Posted On2016-11-08