Incidental Mutation 'R5649:Cdh22'
ID441306
Institutional Source Beutler Lab
Gene Symbol Cdh22
Ensembl Gene ENSMUSG00000053166
Gene Namecadherin 22
SynonymsPB-cadherin
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165111507-165234853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 165116280 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 589 (T589K)
Ref Sequence ENSEMBL: ENSMUSP00000066864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065438] [ENSMUST00000138643]
Predicted Effect probably damaging
Transcript: ENSMUST00000065438
AA Change: T589K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066864
Gene: ENSMUSG00000053166
AA Change: T589K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
CA 413 494 2.27e-23 SMART
CA 517 604 4.52e-9 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 803 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138643
SMART Domains Protein: ENSMUSP00000120785
Gene: ENSMUSG00000053166

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
CA 82 163 2.19e-16 SMART
CA 187 272 3.11e-30 SMART
CA 296 390 4.88e-14 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. The gene product is composed of five cadherin repeat domains and a cytoplasmic tail similar to the highly conserved cytoplasmic region of classical cadherins. Expressed predominantly in the brain, this putative calcium-dependent cell adhesion protein may play an important role in morphogenesis and tissue formation in neural and non-neural cells during development and maintenance of the brain and neuroendocrine organs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Cdh22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cdh22 APN 2 165112601 missense possibly damaging 0.54
IGL01868:Cdh22 APN 2 165157358 missense probably damaging 0.99
IGL01932:Cdh22 APN 2 165170808 missense probably benign 0.05
IGL02268:Cdh22 APN 2 165123719 splice site probably benign
IGL02455:Cdh22 APN 2 165142255 missense possibly damaging 0.46
IGL03231:Cdh22 APN 2 165116206 missense probably benign 0.16
IGL03264:Cdh22 APN 2 165116173 missense probably benign 0.21
IGL03014:Cdh22 UTSW 2 165112411 nonsense probably null
R0712:Cdh22 UTSW 2 165170656 missense probably damaging 1.00
R0865:Cdh22 UTSW 2 165181056 missense probably damaging 0.98
R1192:Cdh22 UTSW 2 165135283 missense probably damaging 1.00
R1700:Cdh22 UTSW 2 165170796 missense probably damaging 1.00
R1844:Cdh22 UTSW 2 165143694 missense probably damaging 1.00
R2005:Cdh22 UTSW 2 165180923 missense probably damaging 1.00
R2137:Cdh22 UTSW 2 165116394 splice site probably benign
R2270:Cdh22 UTSW 2 165143847 splice site probably null
R2271:Cdh22 UTSW 2 165143847 splice site probably null
R2272:Cdh22 UTSW 2 165143847 splice site probably null
R4021:Cdh22 UTSW 2 165143673 missense possibly damaging 0.81
R4022:Cdh22 UTSW 2 165157253 missense probably benign 0.14
R4613:Cdh22 UTSW 2 165143656 missense probably benign
R4625:Cdh22 UTSW 2 165112606 missense probably damaging 1.00
R5038:Cdh22 UTSW 2 165142277 missense probably benign 0.16
R5057:Cdh22 UTSW 2 165116143 missense probably damaging 0.98
R6175:Cdh22 UTSW 2 165146630 missense probably damaging 0.98
R6297:Cdh22 UTSW 2 165143644 missense possibly damaging 0.86
R6445:Cdh22 UTSW 2 165170692 missense probably damaging 0.97
R7294:Cdh22 UTSW 2 165142093 missense possibly damaging 0.94
R7310:Cdh22 UTSW 2 165112294 nonsense probably null
R7595:Cdh22 UTSW 2 165112463 missense probably benign 0.00
R7601:Cdh22 UTSW 2 165112546 missense probably damaging 1.00
R8047:Cdh22 UTSW 2 165170767 missense probably damaging 1.00
Z1088:Cdh22 UTSW 2 165112430 missense probably benign 0.01
Z1176:Cdh22 UTSW 2 165116184 missense probably damaging 1.00
Z1177:Cdh22 UTSW 2 165146680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTATCCAGGCAGAACACC -3'
(R):5'- CACACTGTCTGCTTCAAGATG -3'

Sequencing Primer
(F):5'- TATCCAGGCAGAACACCAAGTCATG -3'
(R):5'- ACACTGTCTGCTTCAAGATGGGATC -3'
Posted On2016-11-08