Incidental Mutation 'R5649:Vmn1r53'
ID441315
Institutional Source Beutler Lab
Gene Symbol Vmn1r53
Ensembl Gene ENSMUSG00000057697
Gene Namevomeronasal 1 receptor 53
SynonymsVN5, V1rb3
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90223317-90224438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90223760 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 194 (A194V)
Ref Sequence ENSEMBL: ENSMUSP00000075455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076086]
Predicted Effect probably benign
Transcript: ENSMUST00000076086
AA Change: A194V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075455
Gene: ENSMUSG00000057697
AA Change: A194V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 1.4e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Vmn1r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03104:Vmn1r53 APN 6 90223962 nonsense probably null
R0087:Vmn1r53 UTSW 6 90223431 missense probably benign 0.03
R0240:Vmn1r53 UTSW 6 90223943 missense probably damaging 1.00
R0240:Vmn1r53 UTSW 6 90223943 missense probably damaging 1.00
R0361:Vmn1r53 UTSW 6 90224082 missense possibly damaging 0.94
R0481:Vmn1r53 UTSW 6 90223718 missense probably damaging 0.99
R1293:Vmn1r53 UTSW 6 90224214 missense possibly damaging 0.69
R1464:Vmn1r53 UTSW 6 90223932 missense probably benign 0.26
R1464:Vmn1r53 UTSW 6 90223932 missense probably benign 0.26
R1901:Vmn1r53 UTSW 6 90224286 missense possibly damaging 0.95
R2508:Vmn1r53 UTSW 6 90223572 missense probably benign 0.00
R5428:Vmn1r53 UTSW 6 90223413 missense probably benign 0.01
R6365:Vmn1r53 UTSW 6 90224259 missense probably damaging 1.00
R7410:Vmn1r53 UTSW 6 90223718 missense probably damaging 0.99
R7608:Vmn1r53 UTSW 6 90224122 missense probably benign 0.04
R7673:Vmn1r53 UTSW 6 90223643 missense probably damaging 1.00
R7951:Vmn1r53 UTSW 6 90224150 missense possibly damaging 0.88
Z1177:Vmn1r53 UTSW 6 90224111 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGGCTGACTGTGGCATAG -3'
(R):5'- TCACACTTAGTCCTAGAAGCTCC -3'

Sequencing Primer
(F):5'- ACTGTGGCATAGCTATGGGAC -3'
(R):5'- GTCCTAGAAGCTCCTATTTAACAAAG -3'
Posted On2016-11-08