Incidental Mutation 'R5649:Cnot3'
ID441317
Institutional Source Beutler Lab
Gene Symbol Cnot3
Ensembl Gene ENSMUSG00000035632
Gene NameCCR4-NOT transcription complex, subunit 3
SynonymsA930039N10Rik
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3645268-3661109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3658083 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 561 (L561S)
Ref Sequence ENSEMBL: ENSMUSP00000039098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019878] [ENSMUST00000038913] [ENSMUST00000160200]
Predicted Effect probably benign
Transcript: ENSMUST00000019878
SMART Domains Protein: ENSMUSP00000019878
Gene: ENSMUSG00000078813

DomainStartEndE-ValueType
Cir_N 8 44 2.43e-9 SMART
low complexity region 94 109 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
coiled coil region 198 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038913
AA Change: L561S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632
AA Change: L561S

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129973
Predicted Effect probably benign
Transcript: ENSMUST00000132344
SMART Domains Protein: ENSMUSP00000117297
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 189 8.9e-77 PFAM
low complexity region 214 231 N/A INTRINSIC
SCOP:d1cpo_2 260 335 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135977
SMART Domains Protein: ENSMUSP00000118822
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 78 1.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143085
Predicted Effect probably benign
Transcript: ENSMUST00000160200
SMART Domains Protein: ENSMUSP00000124810
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:NOT2_3_5 1 83 3.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175549
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show defective outgrowth of the inner cell mass and complete embryonic lethality at implantation. Heterozygotes exhibit decreased cardiac muscle contractility and develop severe cardiomyopathy leading to heart failure in response to pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Cnot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cnot3 APN 7 3650855 missense probably damaging 1.00
IGL02231:Cnot3 APN 7 3658210 missense probably benign 0.00
IGL02476:Cnot3 APN 7 3658068 missense probably benign 0.01
IGL03102:Cnot3 APN 7 3656156 nonsense probably null
IGL03181:Cnot3 APN 7 3653248 missense probably damaging 1.00
secondary UTSW 7 3651919 missense probably damaging 1.00
R4531:Cnot3 UTSW 7 3658074 missense probably benign
R4564:Cnot3 UTSW 7 3653258 missense probably damaging 1.00
R5071:Cnot3 UTSW 7 3650861 missense probably damaging 1.00
R5869:Cnot3 UTSW 7 3644930 unclassified probably benign
R6120:Cnot3 UTSW 7 3645336 splice site probably null
R6759:Cnot3 UTSW 7 3651919 missense probably damaging 1.00
R7305:Cnot3 UTSW 7 3645480 start gained probably benign
R7369:Cnot3 UTSW 7 3653331 missense possibly damaging 0.77
R7860:Cnot3 UTSW 7 3655566 splice site probably null
R7957:Cnot3 UTSW 7 3658222 missense probably benign
R8172:Cnot3 UTSW 7 3658725 missense possibly damaging 0.64
R8415:Cnot3 UTSW 7 3658688 missense probably benign 0.01
RF010:Cnot3 UTSW 7 3656069 missense probably benign 0.01
Z1177:Cnot3 UTSW 7 3651495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGAGTGTACAGAGCCTATC -3'
(R):5'- TGTTCACCTCTGACAGCTGC -3'

Sequencing Primer
(F):5'- AATTGAACTCGGGACCTCTG -3'
(R):5'- TCTGACAGCTGCAGGGGTG -3'
Posted On2016-11-08