Incidental Mutation 'R5649:Olfr304'
ID441321
Institutional Source Beutler Lab
Gene Symbol Olfr304
Ensembl Gene ENSMUSG00000062426
Gene Nameolfactory receptor 304
SynonymsGA_x6K02T2NHDJ-9721756-9722757, MOR219-3P
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86385657-86386658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86386313 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 116 (M116V)
Ref Sequence ENSEMBL: ENSMUSP00000076449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077210]
Predicted Effect probably damaging
Transcript: ENSMUST00000077210
AA Change: M116V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: M116V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8.9e-38 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Olfr304
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Olfr304 APN 7 86386000 missense possibly damaging 0.95
IGL02152:Olfr304 APN 7 86386043 missense probably benign 0.00
IGL02540:Olfr304 APN 7 86386178 missense possibly damaging 0.86
IGL03108:Olfr304 APN 7 86385721 missense possibly damaging 0.95
IGL03374:Olfr304 APN 7 86386366 missense probably damaging 1.00
R0040:Olfr304 UTSW 7 86386507 missense probably benign 0.01
R0130:Olfr304 UTSW 7 86386306 missense probably damaging 1.00
R0194:Olfr304 UTSW 7 86386374 nonsense probably null
R0267:Olfr304 UTSW 7 86386267 missense possibly damaging 0.64
R1026:Olfr304 UTSW 7 86386259 missense probably damaging 0.98
R1865:Olfr304 UTSW 7 86386561 missense probably damaging 1.00
R2090:Olfr304 UTSW 7 86386081 missense probably benign 0.01
R3607:Olfr304 UTSW 7 86385695 missense probably benign
R3861:Olfr304 UTSW 7 86386123 missense possibly damaging 0.60
R3909:Olfr304 UTSW 7 86385974 missense probably benign 0.05
R4113:Olfr304 UTSW 7 86386525 missense possibly damaging 0.83
R5268:Olfr304 UTSW 7 86385659 makesense probably null
R6343:Olfr304 UTSW 7 86385851 nonsense probably null
R7716:Olfr304 UTSW 7 86386054 missense probably benign 0.22
X0054:Olfr304 UTSW 7 86385730 missense probably benign 0.00
X0063:Olfr304 UTSW 7 86386492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTAGTAACGAGGGAACATCAC -3'
(R):5'- CACGGTCATCACTCTGGATC -3'

Sequencing Primer
(F):5'- CAGAAAAACTGTGGGATCACC -3'
(R):5'- GGTCATCACTCTGGATCTGAAAC -3'
Posted On2016-11-08