Mutagenetix > Incidental Mutations

Incidental Mutation 'R5649:Apc2'

441328

Institutional Source

Beutler Lab

Gene Symbol

Apc2

Ensembl Gene

ENSMUSG00000020135

Gene Name

adenomatosis polyposis coli 2

Synonyms

APCL

MMRRC Submission

043170-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R5649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80295977-80318263 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80314138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1646 (D1646E)

Ref Sequence

ENSEMBL: ENSMUSP00000020349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020341] [ENSMUST00000020349] [ENSMUST00000105359]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020341

SMART Domains

Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

Domain	Start	End	E-Value	Type
Pfam:UPF0449	6	103	7.5e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000020349
AA Change: D1646E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: D1646E

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	4	57	9e-17	PDB
Pfam:Suppressor_APC	123	205	1.3e-28	PFAM
coiled coil region	214	236	N/A	INTRINSIC
low complexity region	242	261	N/A	INTRINSIC
ARM	300	355	2.95e0	SMART
ARM	417	468	2.22e-2	SMART
ARM	470	511	3.22e0	SMART
ARM	513	555	3.56e-1	SMART
ARM	557	602	2.1e1	SMART
ARM	607	647	1.82e-7	SMART
Blast:ARM	649	689	6e-18	BLAST
low complexity region	772	792	N/A	INTRINSIC
low complexity region	817	844	N/A	INTRINSIC
low complexity region	859	870	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1087	1103	N/A	INTRINSIC
Pfam:APC_crr	1134	1159	4.4e-9	PFAM
low complexity region	1197	1208	N/A	INTRINSIC
Pfam:APC_crr	1244	1269	4.1e-8	PFAM
Pfam:SAMP	1323	1343	2.1e-10	PFAM
Pfam:APC_crr	1369	1394	5.8e-8	PFAM
low complexity region	1500	1516	N/A	INTRINSIC
Pfam:APC_crr	1540	1565	5.7e-8	PFAM
Pfam:SAMP	1594	1613	8.8e-11	PFAM
low complexity region	1673	1699	N/A	INTRINSIC
Pfam:APC_basic	1757	2093	1.1e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105359
AA Change: D1675E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: D1675E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:APC_N_CC	30	81	2.7e-34	PFAM
Pfam:Suppressor_APC	148	228	1.4e-27	PFAM
coiled coil region	238	260	N/A	INTRINSIC
low complexity region	266	285	N/A	INTRINSIC
ARM	324	379	2.95e0	SMART
ARM	446	497	2.22e-2	SMART
ARM	499	540	3.22e0	SMART
ARM	542	584	3.56e-1	SMART
ARM	586	631	2.1e1	SMART
ARM	636	676	1.82e-7	SMART
Blast:ARM	678	718	6e-18	BLAST
Pfam:Arm_APC_u3	719	977	1.1e-26	PFAM
low complexity region	1000	1009	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1116	1132	N/A	INTRINSIC
Pfam:APC_crr	1164	1187	9.3e-8	PFAM
low complexity region	1226	1237	N/A	INTRINSIC
Pfam:APC_crr	1274	1297	7.9e-10	PFAM
Pfam:APC_crr	1399	1423	1.3e-9	PFAM
low complexity region	1529	1545	N/A	INTRINSIC
low complexity region	1585	1603	N/A	INTRINSIC
Pfam:SAMP	1624	1642	1.3e-11	PFAM
low complexity region	1702	1728	N/A	INTRINSIC
Pfam:APC_basic	1786	2122	1.3e-122	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,972	E33G	probably benign	Het
Abca12	T	C	1: 71,291,342	T1385A	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Atl3	C	A	19: 7,532,227	T435N	possibly damaging	Het
Cdh22	G	T	2: 165,116,280	T589K	probably damaging	Het
Cnot3	T	C	7: 3,658,083	L561S	probably benign	Het
Col5a1	A	G	2: 27,951,456	D363G	unknown	Het
Cyp24a1	T	C	2: 170,496,309	D105G	possibly damaging	Het
Dennd4a	C	A	9: 64,851,209		probably null	Het
Dnah8	A	G	17: 30,800,587	K3878R	probably benign	Het
Dock4	T	C	12: 40,844,540	S1900P	probably benign	Het
Fancg	A	G	4: 43,008,736	L167P	probably damaging	Het
Ighd2-8	A	G	12: 113,450,867	S1P	possibly damaging	Het
Kif28	A	G	1: 179,697,771		probably null	Het
Mrpl55	T	A	11: 59,204,571	C20*	probably null	Het
Myo5a	A	G	9: 75,171,719	K920E	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Olfm3	A	G	3: 115,096,924	R76G	probably damaging	Het
Olfr304	T	C	7: 86,386,313	M116V	probably damaging	Het
Olfr705	T	C	7: 106,714,166	R172G	possibly damaging	Het
Pcdha12	A	T	18: 37,022,415	D729V	probably benign	Het
Phf11c	T	C	14: 59,385,532		probably null	Het
Phf20	T	A	2: 156,251,768		probably null	Het
Plbd1	T	A	6: 136,616,989	Y376F	probably benign	Het
Poglut1	A	G	16: 38,531,811	V257A	probably damaging	Het
Reln	A	G	5: 21,901,625	I3249T	probably benign	Het
Rgsl1	G	A	1: 153,825,893	P272S	possibly damaging	Het
Slc15a2	A	T	16: 36,772,110	Y197*	probably null	Het
Slc45a2	C	T	15: 11,012,607	T232I	probably benign	Het
Ssc5d	T	A	7: 4,926,518		probably null	Het
Thbs2	T	C	17: 14,689,953	Y128C	probably damaging	Het
Them4	A	T	3: 94,331,544	L219F	possibly damaging	Het
Tmem30b	G	T	12: 73,546,166	N58K	probably benign	Het
Ttc29	G	A	8: 78,246,313	E131K	possibly damaging	Het
Vmn1r29	C	G	6: 58,307,691	S132C	probably benign	Het
Vmn1r53	G	A	6: 90,223,760	A194V	probably benign	Het
Wdr86	A	T	5: 24,718,087	H202Q	probably benign	Het
Xirp2	A	G	2: 67,516,895	D3160G	probably benign	Het
Xkr5	T	C	8: 18,933,966	D520G	probably benign	Het
Zfp607b	T	G	7: 27,703,981	C621G	probably damaging	Het

Other mutations in Apc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Apc2	APN	10	80311986	missense	probably damaging	1.00
IGL01154:Apc2	APN	10	80313069	missense	possibly damaging	0.90
IGL01411:Apc2	APN	10	80315078	missense	probably damaging	0.99
IGL01598:Apc2	APN	10	80313048	missense	probably damaging	1.00
IGL01621:Apc2	APN	10	80306201	missense	probably damaging	1.00
IGL01720:Apc2	APN	10	80314499	missense	probably benign	0.01
IGL01837:Apc2	APN	10	80314658	missense	probably benign	0.24
IGL01933:Apc2	APN	10	80311740	missense	probably damaging	1.00
IGL02243:Apc2	APN	10	80302341	missense	probably damaging	1.00
IGL02292:Apc2	APN	10	80302424	missense	possibly damaging	0.59
IGL02956:Apc2	APN	10	80306375	missense	probably damaging	1.00
IGL03081:Apc2	APN	10	80312252	missense	probably damaging	1.00
IGL03172:Apc2	APN	10	80313386	missense	probably damaging	0.98
LCD18:Apc2	UTSW	10	80299974	intron	probably benign
R0278:Apc2	UTSW	10	80312813	missense	possibly damaging	0.90
R0501:Apc2	UTSW	10	80315124	missense	probably damaging	1.00
R0594:Apc2	UTSW	10	80306256	nonsense	probably null
R0607:Apc2	UTSW	10	80314101	missense	probably benign
R0624:Apc2	UTSW	10	80314583	missense	probably benign	0.00
R0633:Apc2	UTSW	10	80307455	missense	probably damaging	0.99
R0638:Apc2	UTSW	10	80304967	missense	probably damaging	0.99
R0647:Apc2	UTSW	10	80304928	missense	probably damaging	1.00
R0830:Apc2	UTSW	10	80315405	missense	probably damaging	1.00
R1071:Apc2	UTSW	10	80311502	missense	probably damaging	1.00
R1221:Apc2	UTSW	10	80306380	missense	probably damaging	1.00
R1432:Apc2	UTSW	10	80312349	missense	probably benign	0.00
R1579:Apc2	UTSW	10	80311345	missense	probably damaging	1.00
R1654:Apc2	UTSW	10	80301842	missense	possibly damaging	0.75
R1700:Apc2	UTSW	10	80312769	missense	probably damaging	1.00
R1774:Apc2	UTSW	10	80309130	missense	probably damaging	1.00
R1864:Apc2	UTSW	10	80313648	missense	probably damaging	1.00
R1908:Apc2	UTSW	10	80314844	missense	probably benign	0.05
R1915:Apc2	UTSW	10	80315867	missense	probably benign
R1999:Apc2	UTSW	10	80309160	missense	probably damaging	1.00
R2050:Apc2	UTSW	10	80307609	splice site	probably null
R2219:Apc2	UTSW	10	80309109	missense	probably benign	0.41
R2393:Apc2	UTSW	10	80313069	missense	possibly damaging	0.90
R3862:Apc2	UTSW	10	80307559	missense	possibly damaging	0.82
R3900:Apc2	UTSW	10	80295972	splice site	probably null
R3901:Apc2	UTSW	10	80315088	missense	possibly damaging	0.94
R3952:Apc2	UTSW	10	80314484	missense	probably damaging	1.00
R4009:Apc2	UTSW	10	80313592	missense	probably benign	0.00
R4090:Apc2	UTSW	10	80305544	missense	probably damaging	0.97
R4695:Apc2	UTSW	10	80311043	missense	probably damaging	1.00
R4754:Apc2	UTSW	10	80314358	missense	probably benign	0.01
R4807:Apc2	UTSW	10	80314362	missense	probably benign	0.13
R4886:Apc2	UTSW	10	80314213	missense	probably damaging	1.00
R4964:Apc2	UTSW	10	80314007	missense	probably benign	0.14
R5056:Apc2	UTSW	10	80301314	missense	probably benign
R5057:Apc2	UTSW	10	80309069	missense	probably damaging	0.99
R5165:Apc2	UTSW	10	80315850	missense	probably damaging	0.99
R5241:Apc2	UTSW	10	80312234	missense	probably benign
R5924:Apc2	UTSW	10	80312150	missense	probably damaging	1.00
R6124:Apc2	UTSW	10	80306351	missense	probably damaging	0.98
R6218:Apc2	UTSW	10	80306420	missense	probably damaging	0.98
R6376:Apc2	UTSW	10	80312654	missense	probably damaging	1.00
R6490:Apc2	UTSW	10	80313923	missense	probably benign	0.01
R6572:Apc2	UTSW	10	80311779	missense	probably damaging	1.00
R6620:Apc2	UTSW	10	80313567	missense	probably damaging	0.97
R7171:Apc2	UTSW	10	80315336	missense	possibly damaging	0.65
R7180:Apc2	UTSW	10	80311156	missense	possibly damaging	0.94
R7326:Apc2	UTSW	10	80311740	missense	probably damaging	1.00
R7340:Apc2	UTSW	10	80313482	missense	probably benign	0.12
R7378:Apc2	UTSW	10	80311394	missense	probably damaging	1.00
R7384:Apc2	UTSW	10	80312624	missense	probably damaging	1.00
R7431:Apc2	UTSW	10	80302183	missense	possibly damaging	0.83
R7543:Apc2	UTSW	10	80314886	missense	possibly damaging	0.72
R7743:Apc2	UTSW	10	80304915	missense	probably damaging	0.99
R7759:Apc2	UTSW	10	80311196	missense	probably damaging	1.00
R8244:Apc2	UTSW	10	80315332	missense	probably damaging	0.99
R8327:Apc2	UTSW	10	80301930	missense	probably damaging	1.00
R8489:Apc2	UTSW	10	80307464	missense	probably damaging	1.00
R8494:Apc2	UTSW	10	80314479	missense	probably damaging	1.00
R8669:Apc2	UTSW	10	80313657	missense	probably damaging	1.00
R8773:Apc2	UTSW	10	80306212	missense	probably damaging	1.00
R8920:Apc2	UTSW	10	80314100	missense	probably benign
R9178:Apc2	UTSW	10	80314401	missense	probably benign	0.11
R9224:Apc2	UTSW	10	80314277	missense	probably damaging	0.97
R9357:Apc2	UTSW	10	80311038	missense	probably damaging	1.00
R9394:Apc2	UTSW	10	80309172	missense	probably damaging	1.00
X0018:Apc2	UTSW	10	80312264	missense	probably benign	0.02
Z1177:Apc2	UTSW	10	80312036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTAAACAGGACAGCTCTCCTAG -3'
(R):5'- AGTTGTGCCCCGTTTCTCAG -3'

Sequencing Primer
(F):5'- GCTCTCCTAGCCCAAGGG -3'
(R):5'- CCCTTTCCTGAGCTTGGAGG -3'

Posted On

2016-11-08