Mutagenetix > Incidental Mutations

Incidental Mutation 'R5649:Mrpl55'

441330

Institutional Source

Beutler Lab

Gene Symbol

Mrpl55

Ensembl Gene

ENSMUSG00000036860

Gene Name

mitochondrial ribosomal protein L55

Synonyms

MMRRC Submission

043170-MU

Accession Numbers

Is this an essential gene?

Not available question?

Stock #

R5649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59202486-59206134 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 59204571 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 20 (C20*)

Ref Sequence

ENSEMBL: ENSMUSP00000104415 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020719] [ENSMUST00000045697] [ENSMUST00000108784] [ENSMUST00000108785] [ENSMUST00000108786] [ENSMUST00000108787]

Predicted Effect

probably benign
Transcript: ENSMUST00000020719

SMART Domains

Protein: ENSMUSP00000020719
Gene: ENSMUSG00000020441

Domain	Start	End	E-Value	Type
Pfam:MMtag	8	83	5.7e-34	PFAM
low complexity region	117	135	N/A	INTRINSIC
low complexity region	180	208	N/A	INTRINSIC
low complexity region	215	224	N/A	INTRINSIC
low complexity region	250	260	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000045697
AA Change: C13*

SMART Domains

Protein: ENSMUSP00000048814
Gene: ENSMUSG00000036860
AA Change: C13*

Domain	Start	End	E-Value	Type
Pfam:Mitoc_L55	6	124	9.7e-56	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000101158

Predicted Effect

probably null
Transcript: ENSMUST00000108784
AA Change: C20*

SMART Domains

Protein: ENSMUSP00000104412
Gene: ENSMUSG00000036860
AA Change: C20*

Domain	Start	End	E-Value	Type
Pfam:Mitoc_L55	16	131	6.6e-61	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108785
AA Change: C13*

SMART Domains

Protein: ENSMUSP00000104413
Gene: ENSMUSG00000036860
AA Change: C13*

Domain	Start	End	E-Value	Type
Pfam:Mitoc_L55	6	124	9.7e-56	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108786
AA Change: C20*

SMART Domains

Protein: ENSMUSP00000104414
Gene: ENSMUSG00000036860
AA Change: C20*

Domain	Start	End	E-Value	Type
Pfam:Mitoc_L55	13	131	4.4e-55	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000108787
AA Change: C20*

SMART Domains

Protein: ENSMUSP00000104415
Gene: ENSMUSG00000036860
AA Change: C20*

Domain	Start	End	E-Value	Type
Pfam:Mitoc_L55	13	131	4.4e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154354

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,972	E33G	probably benign	Het
Abca12	T	C	1: 71,291,342	T1385A	probably damaging	Het
Apc2	T	A	10: 80,314,138	D1646E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Atl3	C	A	19: 7,532,227	T435N	possibly damaging	Het
Cdh22	G	T	2: 165,116,280	T589K	probably damaging	Het
Cnot3	T	C	7: 3,658,083	L561S	probably benign	Het
Col5a1	A	G	2: 27,951,456	D363G	unknown	Het
Cyp24a1	T	C	2: 170,496,309	D105G	possibly damaging	Het
Dennd4a	C	A	9: 64,851,209		probably null	Het
Dnah8	A	G	17: 30,800,587	K3878R	probably benign	Het
Dock4	T	C	12: 40,844,540	S1900P	probably benign	Het
Fancg	A	G	4: 43,008,736	L167P	probably damaging	Het
Ighd2-8	A	G	12: 113,450,867	S1P	possibly damaging	Het
Kif28	A	G	1: 179,697,771		probably null	Het
Myo5a	A	G	9: 75,171,719	K920E	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Olfm3	A	G	3: 115,096,924	R76G	probably damaging	Het
Olfr304	T	C	7: 86,386,313	M116V	probably damaging	Het
Olfr705	T	C	7: 106,714,166	R172G	possibly damaging	Het
Pcdha12	A	T	18: 37,022,415	D729V	probably benign	Het
Phf11c	T	C	14: 59,385,532		probably null	Het
Phf20	T	A	2: 156,251,768		probably null	Het
Plbd1	T	A	6: 136,616,989	Y376F	probably benign	Het
Poglut1	A	G	16: 38,531,811	V257A	probably damaging	Het
Reln	A	G	5: 21,901,625	I3249T	probably benign	Het
Rgsl1	G	A	1: 153,825,893	P272S	possibly damaging	Het
Slc15a2	A	T	16: 36,772,110	Y197*	probably null	Het
Slc45a2	C	T	15: 11,012,607	T232I	probably benign	Het
Ssc5d	T	A	7: 4,926,518		probably null	Het
Thbs2	T	C	17: 14,689,953	Y128C	probably damaging	Het
Them4	A	T	3: 94,331,544	L219F	possibly damaging	Het
Tmem30b	G	T	12: 73,546,166	N58K	probably benign	Het
Ttc29	G	A	8: 78,246,313	E131K	possibly damaging	Het
Vmn1r29	C	G	6: 58,307,691	S132C	probably benign	Het
Vmn1r53	G	A	6: 90,223,760	A194V	probably benign	Het
Wdr86	A	T	5: 24,718,087	H202Q	probably benign	Het
Xirp2	A	G	2: 67,516,895	D3160G	probably benign	Het
Xkr5	T	C	8: 18,933,966	D520G	probably benign	Het
Zfp607b	T	G	7: 27,703,981	C621G	probably damaging	Het

Other mutations in Mrpl55

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Mrpl55	APN	11	59205673	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- AGTGTAGTTCAATGGAGGTCC -3'
(R):5'- ACTATGGCTCAGCAAGTACC -3'

Sequencing Primer
(F):5'- GAGGTCCTTAAATGCAAGCCGTC -3'
(R):5'- TATGGCTCAGCAAGTACCTACTG -3'

Posted On

2016-11-08