Mutagenetix > Incidental Mutations

Incidental Mutation 'R5649:Slc15a2'

441338

Institutional Source

Beutler Lab

Gene Symbol

Slc15a2

Ensembl Gene

ENSMUSG00000022899

Gene Name

solute carrier family 15 (H+/peptide transporter), member 2

Synonyms

8430408C16Rik, Pept2

MMRRC Submission

043170-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R5649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36750177-36784962 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 36772110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 197 (Y197*)

Ref Sequence

ENSEMBL: ENSMUSP00000132663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023616] [ENSMUST00000164579] [ENSMUST00000165380] [ENSMUST00000165531] [ENSMUST00000168279]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000023616
AA Change: Y228*

SMART Domains

Protein: ENSMUSP00000023616
Gene: ENSMUSG00000022899
AA Change: Y228*

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	122	500	1.7e-122	PFAM
Pfam:PTR2	593	686	2.5e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000164579
AA Change: Y228*

SMART Domains

Protein: ENSMUSP00000132029
Gene: ENSMUSG00000022899
AA Change: Y228*

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	122	244	7.3e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165380

SMART Domains

Protein: ENSMUSP00000131395
Gene: ENSMUSG00000022899

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165531
AA Change: Y197*

SMART Domains

Protein: ENSMUSP00000132663
Gene: ENSMUSG00000022899
AA Change: Y197*

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	99	469	2.4e-105	PFAM
PDB:2XUT\|C	583	642	3e-10	PDB
transmembrane domain	655	677	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166399

Predicted Effect

probably benign
Transcript: ENSMUST00000168279

SMART Domains

Protein: ENSMUSP00000132885
Gene: ENSMUSG00000022899

Domain	Start	End	E-Value	Type
low complexity region	35	47	N/A	INTRINSIC
Pfam:PTR2	122	189	4.1e-27	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Homozygous mutant mice have impairments of dipeptide transportion, however, show no gross defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,972	E33G	probably benign	Het
Abca12	T	C	1: 71,291,342	T1385A	probably damaging	Het
Apc2	T	A	10: 80,314,138	D1646E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Atl3	C	A	19: 7,532,227	T435N	possibly damaging	Het
Cdh22	G	T	2: 165,116,280	T589K	probably damaging	Het
Cnot3	T	C	7: 3,658,083	L561S	probably benign	Het
Col5a1	A	G	2: 27,951,456	D363G	unknown	Het
Cyp24a1	T	C	2: 170,496,309	D105G	possibly damaging	Het
Dennd4a	C	A	9: 64,851,209		probably null	Het
Dnah8	A	G	17: 30,800,587	K3878R	probably benign	Het
Dock4	T	C	12: 40,844,540	S1900P	probably benign	Het
Fancg	A	G	4: 43,008,736	L167P	probably damaging	Het
Ighd2-8	A	G	12: 113,450,867	S1P	possibly damaging	Het
Kif28	A	G	1: 179,697,771		probably null	Het
Mrpl55	T	A	11: 59,204,571	C20*	probably null	Het
Myo5a	A	G	9: 75,171,719	K920E	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Olfm3	A	G	3: 115,096,924	R76G	probably damaging	Het
Olfr304	T	C	7: 86,386,313	M116V	probably damaging	Het
Olfr705	T	C	7: 106,714,166	R172G	possibly damaging	Het
Pcdha12	A	T	18: 37,022,415	D729V	probably benign	Het
Phf11c	T	C	14: 59,385,532		probably null	Het
Phf20	T	A	2: 156,251,768		probably null	Het
Plbd1	T	A	6: 136,616,989	Y376F	probably benign	Het
Poglut1	A	G	16: 38,531,811	V257A	probably damaging	Het
Reln	A	G	5: 21,901,625	I3249T	probably benign	Het
Rgsl1	G	A	1: 153,825,893	P272S	possibly damaging	Het
Slc45a2	C	T	15: 11,012,607	T232I	probably benign	Het
Ssc5d	T	A	7: 4,926,518		probably null	Het
Thbs2	T	C	17: 14,689,953	Y128C	probably damaging	Het
Them4	A	T	3: 94,331,544	L219F	possibly damaging	Het
Tmem30b	G	T	12: 73,546,166	N58K	probably benign	Het
Ttc29	G	A	8: 78,246,313	E131K	possibly damaging	Het
Vmn1r29	C	G	6: 58,307,691	S132C	probably benign	Het
Vmn1r53	G	A	6: 90,223,760	A194V	probably benign	Het
Wdr86	A	T	5: 24,718,087	H202Q	probably benign	Het
Xirp2	A	G	2: 67,516,895	D3160G	probably benign	Het
Xkr5	T	C	8: 18,933,966	D520G	probably benign	Het
Zfp607b	T	G	7: 27,703,981	C621G	probably damaging	Het

Other mutations in Slc15a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Slc15a2	APN	16	36753775	missense	probably benign	0.00
IGL00703:Slc15a2	APN	16	36757791	missense	probably benign	0.00
IGL00937:Slc15a2	APN	16	36751880	nonsense	probably null
IGL01511:Slc15a2	APN	16	36784726	missense	probably damaging	0.99
IGL01739:Slc15a2	APN	16	36756230	missense	probably benign
IGL02069:Slc15a2	APN	16	36759251	missense	probably benign	0.02
IGL02076:Slc15a2	APN	16	36762381	missense	probably damaging	1.00
IGL02254:Slc15a2	APN	16	36760087	missense	possibly damaging	0.93
IGL02387:Slc15a2	APN	16	36751775	splice site	probably null
IGL02507:Slc15a2	APN	16	36781659	missense	possibly damaging	0.87
IGL02829:Slc15a2	APN	16	36757193	missense	possibly damaging	0.92
IGL03114:Slc15a2	APN	16	36751905	missense	probably damaging	1.00
IGL03227:Slc15a2	APN	16	36756048	critical splice donor site	probably null
PIT4581001:Slc15a2	UTSW	16	36772043	missense	probably benign
R0058:Slc15a2	UTSW	16	36754547	missense	probably benign	0.08
R0058:Slc15a2	UTSW	16	36754547	missense	probably benign	0.08
R0083:Slc15a2	UTSW	16	36782283	missense	probably damaging	1.00
R0099:Slc15a2	UTSW	16	36753036	missense	probably damaging	1.00
R0104:Slc15a2	UTSW	16	36774635	missense	possibly damaging	0.79
R0402:Slc15a2	UTSW	16	36775598	missense	probably benign	0.00
R0619:Slc15a2	UTSW	16	36759307	missense	probably damaging	1.00
R0963:Slc15a2	UTSW	16	36774573	missense	probably damaging	1.00
R0972:Slc15a2	UTSW	16	36757139	missense	probably benign	0.00
R1440:Slc15a2	UTSW	16	36784643	splice site	probably benign
R1471:Slc15a2	UTSW	16	36753791	missense	probably damaging	0.99
R1569:Slc15a2	UTSW	16	36756383	missense	probably benign	0.00
R1616:Slc15a2	UTSW	16	36754481	missense	probably benign
R2246:Slc15a2	UTSW	16	36762361	missense	probably damaging	1.00
R2405:Slc15a2	UTSW	16	36751837	nonsense	probably null
R3834:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3835:Slc15a2	UTSW	16	36772128	nonsense	probably null
R3885:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3887:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3888:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R3889:Slc15a2	UTSW	16	36782304	missense	probably damaging	1.00
R4105:Slc15a2	UTSW	16	36782393	intron	probably benign
R4108:Slc15a2	UTSW	16	36782393	intron	probably benign
R4254:Slc15a2	UTSW	16	36754490	missense	probably benign	0.04
R4352:Slc15a2	UTSW	16	36772028	missense	probably benign	0.08
R4684:Slc15a2	UTSW	16	36757849	missense	probably damaging	1.00
R4747:Slc15a2	UTSW	16	36772136	missense	probably damaging	0.98
R4774:Slc15a2	UTSW	16	36781695	nonsense	probably null
R5151:Slc15a2	UTSW	16	36752297	missense	probably damaging	1.00
R5503:Slc15a2	UTSW	16	36762385	missense	probably damaging	1.00
R6003:Slc15a2	UTSW	16	36754548	missense	probably benign	0.00
R6261:Slc15a2	UTSW	16	36761611	missense	probably benign	0.25
R6329:Slc15a2	UTSW	16	36751782	missense	possibly damaging	0.94
R6409:Slc15a2	UTSW	16	36761870	missense	probably benign	0.00
R6523:Slc15a2	UTSW	16	36752321	missense	probably benign	0.17
R7125:Slc15a2	UTSW	16	36782298	missense	probably damaging	1.00
R7208:Slc15a2	UTSW	16	36756281	missense	probably benign	0.02
R7234:Slc15a2	UTSW	16	36757811	missense	probably benign	0.05
R7374:Slc15a2	UTSW	16	36751845	missense	probably benign	0.01
R7545:Slc15a2	UTSW	16	36775602	missense	probably damaging	1.00
R7559:Slc15a2	UTSW	16	36751897	missense	probably benign
R7611:Slc15a2	UTSW	16	36756311	missense	probably benign	0.18
R7787:Slc15a2	UTSW	16	36751866	missense	probably benign	0.02
R7825:Slc15a2	UTSW	16	36753034	missense	possibly damaging	0.94
R8324:Slc15a2	UTSW	16	36759307	missense	probably damaging	1.00
R9035:Slc15a2	UTSW	16	36782357	missense	possibly damaging	0.82
R9037:Slc15a2	UTSW	16	36762363	missense	probably benign	0.11
R9212:Slc15a2	UTSW	16	36781691	nonsense	probably null
R9273:Slc15a2	UTSW	16	36753728	missense	probably benign	0.01
R9363:Slc15a2	UTSW	16	36752310	missense	possibly damaging	0.91
R9368:Slc15a2	UTSW	16	36753718	missense	probably benign	0.00
T0722:Slc15a2	UTSW	16	36772445	missense	probably benign
V8831:Slc15a2	UTSW	16	36772445	missense	probably benign
X0066:Slc15a2	UTSW	16	36753789	nonsense	probably null
Z1088:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1176:Slc15a2	UTSW	16	36759316	critical splice acceptor site	probably null
Z1176:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36772445	missense	probably benign
Z1177:Slc15a2	UTSW	16	36784687	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGAAACCACTGCAATGAGGC -3'
(R):5'- CCGTTCCTATGGGCTTATAAGTATGTG -3'

Sequencing Primer
(F):5'- ACTGCAATGAGGCTTGCCTG -3'
(R):5'- AGAAGTTGTTTTAGTTTCAACTGGTC -3'

Posted On

2016-11-08