Mutagenetix > Incidental Mutations

Incidental Mutation 'R5649:Poglut1'

441339

Institutional Source

Beutler Lab

Gene Symbol

Poglut1

Ensembl Gene

ENSMUSG00000034064

Gene Name

protein O-glucosyltransferase 1

Synonyms

Rumi, Ktelc1, 9630046K23Rik

MMRRC Submission

043170-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5649 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38525137-38550258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38531811 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 257 (V257A)

Ref Sequence

ENSEMBL: ENSMUSP00000038166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036210]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036210
AA Change: V257A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064
AA Change: V257A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CAP10	121	373	6.69e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153187

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,972	E33G	probably benign	Het
Abca12	T	C	1: 71,291,342	T1385A	probably damaging	Het
Apc2	T	A	10: 80,314,138	D1646E	probably damaging	Het
Aspm	G	A	1: 139,479,669	R2098H	probably benign	Het
Atl3	C	A	19: 7,532,227	T435N	possibly damaging	Het
Cdh22	G	T	2: 165,116,280	T589K	probably damaging	Het
Cnot3	T	C	7: 3,658,083	L561S	probably benign	Het
Col5a1	A	G	2: 27,951,456	D363G	unknown	Het
Cyp24a1	T	C	2: 170,496,309	D105G	possibly damaging	Het
Dennd4a	C	A	9: 64,851,209		probably null	Het
Dnah8	A	G	17: 30,800,587	K3878R	probably benign	Het
Dock4	T	C	12: 40,844,540	S1900P	probably benign	Het
Fancg	A	G	4: 43,008,736	L167P	probably damaging	Het
Ighd2-8	A	G	12: 113,450,867	S1P	possibly damaging	Het
Kif28	A	G	1: 179,697,771		probably null	Het
Mrpl55	T	A	11: 59,204,571	C20*	probably null	Het
Myo5a	A	G	9: 75,171,719	K920E	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Olfm3	A	G	3: 115,096,924	R76G	probably damaging	Het
Olfr304	T	C	7: 86,386,313	M116V	probably damaging	Het
Olfr705	T	C	7: 106,714,166	R172G	possibly damaging	Het
Pcdha12	A	T	18: 37,022,415	D729V	probably benign	Het
Phf11c	T	C	14: 59,385,532		probably null	Het
Phf20	T	A	2: 156,251,768		probably null	Het
Plbd1	T	A	6: 136,616,989	Y376F	probably benign	Het
Reln	A	G	5: 21,901,625	I3249T	probably benign	Het
Rgsl1	G	A	1: 153,825,893	P272S	possibly damaging	Het
Slc15a2	A	T	16: 36,772,110	Y197*	probably null	Het
Slc45a2	C	T	15: 11,012,607	T232I	probably benign	Het
Ssc5d	T	A	7: 4,926,518		probably null	Het
Thbs2	T	C	17: 14,689,953	Y128C	probably damaging	Het
Them4	A	T	3: 94,331,544	L219F	possibly damaging	Het
Tmem30b	G	T	12: 73,546,166	N58K	probably benign	Het
Ttc29	G	A	8: 78,246,313	E131K	possibly damaging	Het
Vmn1r29	C	G	6: 58,307,691	S132C	probably benign	Het
Vmn1r53	G	A	6: 90,223,760	A194V	probably benign	Het
Wdr86	A	T	5: 24,718,087	H202Q	probably benign	Het
Xirp2	A	G	2: 67,516,895	D3160G	probably benign	Het
Xkr5	T	C	8: 18,933,966	D520G	probably benign	Het
Zfp607b	T	G	7: 27,703,981	C621G	probably damaging	Het

Other mutations in Poglut1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Poglut1	APN	16	38542916	missense	possibly damaging	0.96
R0646:Poglut1	UTSW	16	38529475	missense	probably damaging	0.99
R0799:Poglut1	UTSW	16	38534721	splice site	probably null
R2025:Poglut1	UTSW	16	38537905	critical splice donor site	probably null
R2054:Poglut1	UTSW	16	38534807	missense	probably damaging	1.00
R4514:Poglut1	UTSW	16	38549416	missense	probably benign	0.00
R4770:Poglut1	UTSW	16	38534757	missense	probably damaging	1.00
R5893:Poglut1	UTSW	16	38529595	missense	probably damaging	0.99
R6796:Poglut1	UTSW	16	38529610	missense	probably damaging	1.00
R7404:Poglut1	UTSW	16	38537922	missense	possibly damaging	0.88
R8028:Poglut1	UTSW	16	38534733	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATGTCTACTACCATGTTGTAGCC -3'
(R):5'- TGGCCTCTTAGTTCAAAGGAAGG -3'

Sequencing Primer
(F):5'- TACCATGTTGTAGCCGCAAC -3'
(R):5'- GACACTGAATAAGTCCCCGTTTG -3'

Posted On

2016-11-08