Incidental Mutation 'R5649:Poglut1'
ID 441339
Institutional Source Beutler Lab
Gene Symbol Poglut1
Ensembl Gene ENSMUSG00000034064
Gene Name protein O-glucosyltransferase 1
Synonyms Rumi, Ktelc1, 9630046K23Rik
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5649 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 38525137-38550258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38531811 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 257 (V257A)
Ref Sequence ENSEMBL: ENSMUSP00000038166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036210]
AlphaFold Q8BYB9
Predicted Effect probably damaging
Transcript: ENSMUST00000036210
AA Change: V257A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064
AA Change: V257A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153187
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Atl3 C A 19: 7,532,227 T435N possibly damaging Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Poglut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Poglut1 APN 16 38542916 missense possibly damaging 0.96
R0646:Poglut1 UTSW 16 38529475 missense probably damaging 0.99
R0799:Poglut1 UTSW 16 38534721 splice site probably null
R2025:Poglut1 UTSW 16 38537905 critical splice donor site probably null
R2054:Poglut1 UTSW 16 38534807 missense probably damaging 1.00
R4514:Poglut1 UTSW 16 38549416 missense probably benign 0.00
R4770:Poglut1 UTSW 16 38534757 missense probably damaging 1.00
R5893:Poglut1 UTSW 16 38529595 missense probably damaging 0.99
R6796:Poglut1 UTSW 16 38529610 missense probably damaging 1.00
R7404:Poglut1 UTSW 16 38537922 missense possibly damaging 0.88
R8028:Poglut1 UTSW 16 38534733 missense probably damaging 0.99
R9227:Poglut1 UTSW 16 38534806 missense possibly damaging 0.89
R9368:Poglut1 UTSW 16 38529488 missense probably damaging 0.99
R9378:Poglut1 UTSW 16 38526771 missense possibly damaging 0.90
R9408:Poglut1 UTSW 16 38526775 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGTCTACTACCATGTTGTAGCC -3'
(R):5'- TGGCCTCTTAGTTCAAAGGAAGG -3'

Sequencing Primer
(F):5'- TACCATGTTGTAGCCGCAAC -3'
(R):5'- GACACTGAATAAGTCCCCGTTTG -3'
Posted On 2016-11-08