Incidental Mutation 'R5649:Atl3'
ID441342
Institutional Source Beutler Lab
Gene Symbol Atl3
Ensembl Gene ENSMUSG00000024759
Gene Nameatlastin GTPase 3
Synonyms
MMRRC Submission 043170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5649 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7494040-7538608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7532227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 435 (T435N)
Ref Sequence ENSEMBL: ENSMUSP00000132619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025668] [ENSMUST00000170373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025668
AA Change: T440N

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025668
Gene: ENSMUSG00000024759
AA Change: T440N

DomainStartEndE-ValueType
Pfam:GBP 36 310 7.2e-99 PFAM
Pfam:GBP_C 312 438 1.7e-9 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170373
AA Change: T435N

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132619
Gene: ENSMUSG00000024759
AA Change: T435N

DomainStartEndE-ValueType
Pfam:GBP 31 305 9.1e-98 PFAM
Pfam:GBP_C 307 433 7.4e-10 PFAM
transmembrane domain 439 461 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of dynamin-like, integral membrane GTPases. The encoded protein is required for the proper formation of the network of interconnected tubules of the endoplasmic reticulum. Mutations in this gene may be associated with hereditary sensory neuropathy type IF. Alternatively spliced transcript variants that encode distinct isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,972 E33G probably benign Het
Abca12 T C 1: 71,291,342 T1385A probably damaging Het
Apc2 T A 10: 80,314,138 D1646E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Cdh22 G T 2: 165,116,280 T589K probably damaging Het
Cnot3 T C 7: 3,658,083 L561S probably benign Het
Col5a1 A G 2: 27,951,456 D363G unknown Het
Cyp24a1 T C 2: 170,496,309 D105G possibly damaging Het
Dennd4a C A 9: 64,851,209 probably null Het
Dnah8 A G 17: 30,800,587 K3878R probably benign Het
Dock4 T C 12: 40,844,540 S1900P probably benign Het
Fancg A G 4: 43,008,736 L167P probably damaging Het
Ighd2-8 A G 12: 113,450,867 S1P possibly damaging Het
Kif28 A G 1: 179,697,771 probably null Het
Mrpl55 T A 11: 59,204,571 C20* probably null Het
Myo5a A G 9: 75,171,719 K920E possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Olfm3 A G 3: 115,096,924 R76G probably damaging Het
Olfr304 T C 7: 86,386,313 M116V probably damaging Het
Olfr705 T C 7: 106,714,166 R172G possibly damaging Het
Pcdha12 A T 18: 37,022,415 D729V probably benign Het
Phf11c T C 14: 59,385,532 probably null Het
Phf20 T A 2: 156,251,768 probably null Het
Plbd1 T A 6: 136,616,989 Y376F probably benign Het
Poglut1 A G 16: 38,531,811 V257A probably damaging Het
Reln A G 5: 21,901,625 I3249T probably benign Het
Rgsl1 G A 1: 153,825,893 P272S possibly damaging Het
Slc15a2 A T 16: 36,772,110 Y197* probably null Het
Slc45a2 C T 15: 11,012,607 T232I probably benign Het
Ssc5d T A 7: 4,926,518 probably null Het
Thbs2 T C 17: 14,689,953 Y128C probably damaging Het
Them4 A T 3: 94,331,544 L219F possibly damaging Het
Tmem30b G T 12: 73,546,166 N58K probably benign Het
Ttc29 G A 8: 78,246,313 E131K possibly damaging Het
Vmn1r29 C G 6: 58,307,691 S132C probably benign Het
Vmn1r53 G A 6: 90,223,760 A194V probably benign Het
Wdr86 A T 5: 24,718,087 H202Q probably benign Het
Xirp2 A G 2: 67,516,895 D3160G probably benign Het
Xkr5 T C 8: 18,933,966 D520G probably benign Het
Zfp607b T G 7: 27,703,981 C621G probably damaging Het
Other mutations in Atl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02667:Atl3 APN 19 7509416 missense possibly damaging 0.72
R0042:Atl3 UTSW 19 7529023 missense probably damaging 1.00
R0607:Atl3 UTSW 19 7529666 critical splice donor site probably null
R0975:Atl3 UTSW 19 7521135 nonsense probably null
R1582:Atl3 UTSW 19 7516899 missense probably damaging 1.00
R4195:Atl3 UTSW 19 7518546 missense possibly damaging 0.59
R4249:Atl3 UTSW 19 7532338 missense probably benign 0.06
R4505:Atl3 UTSW 19 7520819 missense probably benign 0.00
R4836:Atl3 UTSW 19 7509545 nonsense probably null
R5721:Atl3 UTSW 19 7529011 missense probably benign 0.00
R6459:Atl3 UTSW 19 7520798 missense probably benign 0.07
R6530:Atl3 UTSW 19 7522134 missense probably benign
R6543:Atl3 UTSW 19 7510098 missense probably damaging 1.00
R6550:Atl3 UTSW 19 7522138 missense probably benign
R7059:Atl3 UTSW 19 7533968 missense probably benign
R7059:Atl3 UTSW 19 7533969 missense probably benign 0.08
R7220:Atl3 UTSW 19 7529068 missense probably null 0.02
R7666:Atl3 UTSW 19 7510040 missense probably benign 0.19
X0020:Atl3 UTSW 19 7530569 missense probably benign 0.00
Z1176:Atl3 UTSW 19 7510037 missense probably damaging 1.00
Z1177:Atl3 UTSW 19 7530553 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTCCAGATATTTTAGAAGAGAAGCACC -3'
(R):5'- CTCTAACACATATGCTGCACCG -3'

Sequencing Primer
(F):5'- CCTAGAATTCAAACAACTTGCTCTGG -3'
(R):5'- CATATGCTGCACCGGAGTCAATG -3'
Posted On2016-11-08