Incidental Mutation 'R5650:Npepl1'
ID441350
Institutional Source Beutler Lab
Gene Symbol Npepl1
Ensembl Gene ENSMUSG00000039263
Gene Nameaminopeptidase-like 1
Synonyms
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location174110349-174123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174121536 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 454 (F454L)
Ref Sequence ENSEMBL: ENSMUSP00000042808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044415]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044415
AA Change: F454L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263
AA Change: F454L

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Peptidase_M17 179 484 1.9e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125502
SMART Domains Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263

DomainStartEndE-ValueType
Pfam:Peptidase_M17 104 207 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166709
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Npepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Npepl1 APN 2 174120548 missense probably damaging 1.00
IGL01651:Npepl1 APN 2 174114388 splice site probably benign
IGL01998:Npepl1 APN 2 174116200 splice site probably benign
IGL02079:Npepl1 APN 2 174119390 intron probably benign
R0081:Npepl1 UTSW 2 174116086 missense probably damaging 1.00
R1236:Npepl1 UTSW 2 174114480 critical splice donor site probably null
R2350:Npepl1 UTSW 2 174111773 missense probably benign
R3780:Npepl1 UTSW 2 174120654 missense probably damaging 1.00
R3950:Npepl1 UTSW 2 174121113 missense probably damaging 1.00
R4688:Npepl1 UTSW 2 174114442 missense possibly damaging 0.78
R5916:Npepl1 UTSW 2 174121544 missense probably benign 0.01
R6007:Npepl1 UTSW 2 174121057 missense probably benign 0.03
R6487:Npepl1 UTSW 2 174111732 missense probably benign 0.16
R7267:Npepl1 UTSW 2 174122116 missense probably damaging 1.00
R7881:Npepl1 UTSW 2 174120594 missense probably damaging 1.00
R8103:Npepl1 UTSW 2 174111209 missense probably benign 0.00
Z1177:Npepl1 UTSW 2 174122130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGTCAGAGCCCACTTCTG -3'
(R):5'- ACAGCAGCTACTCTGTTCCC -3'

Sequencing Primer
(F):5'- GAGCCCACTTCTGCCACC -3'
(R):5'- CTGTTCCCAGGGATGAGGAG -3'
Posted On2016-11-08