Mutagenetix > Incidental Mutations

Incidental Mutation 'R5650:Gsap'

441357

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

043296-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R5650 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21251053 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 385 (Y385C)

Ref Sequence

ENSEMBL: ENSMUSP00000142986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036031
AA Change: Y416C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: Y416C

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195969

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197522

Predicted Effect

probably benign
Transcript: ENSMUST00000198014

Predicted Effect

probably benign
Transcript: ENSMUST00000198071

Predicted Effect

probably damaging
Transcript: ENSMUST00000198937
AA Change: Y385C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: Y385C

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	T	C	6: 85,620,271	L693P	probably damaging	Het
Ankrd11	T	C	8: 122,887,397	T2524A	probably damaging	Het
Cdr2	A	G	7: 120,958,336	I322T	probably damaging	Het
Cep76	A	T	18: 67,625,066	C385S	probably damaging	Het
Cercam	C	T	2: 29,881,815	S549F	probably damaging	Het
Coro1b	C	T	19: 4,150,611	T209I	possibly damaging	Het
Dlec1	G	T	9: 119,143,594	E1462*	probably null	Het
Dlgap5	C	T	14: 47,411,739	G166D	probably benign	Het
Ep400	C	T	5: 110,695,952		probably null	Het
Fgr	T	G	4: 133,000,222	V478G	probably benign	Het
Fmo9	T	A	1: 166,663,446	I437F	probably damaging	Het
Gabrd	A	T	4: 155,388,624	V64E	probably damaging	Het
Hat1	T	C	2: 71,434,034	V272A	probably benign	Het
Helz	T	A	11: 107,595,146	M127K	probably null	Het
Hist1h4d	A	T	13: 23,581,795	N65I	possibly damaging	Het
Hsp90b1	G	A	10: 86,693,503	A310V	probably damaging	Het
Hspa4	T	C	11: 53,265,092	Y662C	probably damaging	Het
Kif7	C	T	7: 79,710,979	R216H	probably damaging	Het
Klhl33	A	G	14: 50,891,828	I648T	probably benign	Het
Knl1	T	A	2: 119,081,550	L1716*	probably null	Het
Lgals9	T	A	11: 78,973,154	N55I	probably damaging	Het
Lmo7	A	T	14: 101,898,674	T606S	probably damaging	Het
Mdn1	A	G	4: 32,667,467		probably null	Het
Mip	A	T	10: 128,226,065	I62F	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Npepl1	T	C	2: 174,121,536	F454L	possibly damaging	Het
Oit1	A	T	14: 8,357,142	V96E	probably damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr50	T	A	2: 36,793,265	S10T	probably benign	Het
Olfr63	A	T	17: 33,268,884	E53D	probably benign	Het
Olfr904	A	T	9: 38,464,727	K229*	probably null	Het
Oxct1	T	A	15: 4,142,850	V466D	probably damaging	Het
Piezo2	T	A	18: 63,011,721	I2768F	probably damaging	Het
Pitpnm1	C	A	19: 4,103,319	D158E	possibly damaging	Het
Plekho2	T	C	9: 65,556,736	N277S	probably benign	Het
Rab33b	T	C	3: 51,493,416	Y104H	probably damaging	Het
Rpap1	T	C	2: 119,773,850	S473G	probably benign	Het
Serpina1b	T	A	12: 103,728,435		probably null	Het
Slc25a17	A	T	15: 81,329,176		probably null	Het
Slc43a2	T	C	11: 75,545,807	C160R	probably damaging	Het
Slc7a4	G	T	16: 17,575,684	L84M	possibly damaging	Het
Slco1a4	T	A	6: 141,809,394	I561F	possibly damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Specc1	T	C	11: 62,117,967	I183T	probably damaging	Het
Sucla2	A	G	14: 73,591,129	K362E	probably benign	Het
Tcf12	A	T	9: 71,885,302		probably null	Het
Tlr11	C	T	14: 50,361,201	P215S	probably benign	Het
Tmem41b	A	G	7: 109,974,865	S198P	probably damaging	Het
Tubgcp3	A	G	8: 12,648,670	F427S	probably damaging	Het
Wdr81	T	A	11: 75,444,748	S1752C	probably damaging	Het
Zbtb7a	A	G	10: 81,145,049	Y359C	probably damaging	Het
Zfp37	T	C	4: 62,191,765	Y354C	probably damaging	Het
Zmpste24	T	A	4: 121,082,877	I191F	possibly damaging	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	splice site	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5031:Gsap	UTSW	5	21242826	missense	possibly damaging	0.57
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5469:Gsap	UTSW	5	21290544	missense	possibly damaging	0.92
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6139:Gsap	UTSW	5	21281540	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6859:Gsap	UTSW	5	21281018	missense	probably damaging	0.99
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7234:Gsap	UTSW	5	21186435	missense	probably benign
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
R8126:Gsap	UTSW	5	21270012	missense	probably benign	0.04
R8219:Gsap	UTSW	5	21251115	missense	probably benign	0.00
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTCTGACTGAGGTGAGGTCTTC -3'
(R):5'- CCGAGGAAGACTATGCTCAAGC -3'

Sequencing Primer
(F):5'- AGGTCTTCTATTTGGTGATCTGCTC -3'
(R):5'- CTTCTGATCGTCTCAAAGCACTAAG -3'

Posted On

2016-11-08