Incidental Mutation 'R5650:Gsap'
ID441357
Institutional Source Beutler Lab
Gene Symbol Gsap
Ensembl Gene ENSMUSG00000039934
Gene Namegamma-secretase activating protein
SynonymsA530088I07Rik, Pion
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21186255-21315132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21251053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 385 (Y385C)
Ref Sequence ENSEMBL: ENSMUSP00000142986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]
Predicted Effect probably damaging
Transcript: ENSMUST00000036031
AA Change: Y416C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: Y416C

DomainStartEndE-ValueType
low complexity region 386 398 N/A INTRINSIC
Pfam:GSAP-16 646 753 6.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197522
Predicted Effect probably benign
Transcript: ENSMUST00000198014
Predicted Effect probably benign
Transcript: ENSMUST00000198071
Predicted Effect probably damaging
Transcript: ENSMUST00000198937
AA Change: Y385C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: Y385C

DomainStartEndE-ValueType
low complexity region 355 367 N/A INTRINSIC
Pfam:GSAP-16 608 722 1.6e-42 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Gsap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Gsap APN 5 21221305 splice site probably benign
IGL00788:Gsap APN 5 21254024 missense probably damaging 0.96
IGL01344:Gsap APN 5 21242883 critical splice donor site probably null
IGL01347:Gsap APN 5 21226320 missense probably benign 0.08
IGL01618:Gsap APN 5 21226248 missense probably damaging 1.00
IGL01730:Gsap APN 5 21290154 unclassified probably benign
IGL02061:Gsap APN 5 21281611 splice site probably benign
IGL02161:Gsap APN 5 21253379 missense probably damaging 1.00
IGL02259:Gsap APN 5 21186400 missense probably benign 0.01
IGL02635:Gsap APN 5 21289816 missense probably damaging 1.00
IGL02684:Gsap APN 5 21242803 critical splice acceptor site probably null
IGL02822:Gsap APN 5 21217444 missense probably damaging 1.00
IGL03231:Gsap APN 5 21229166 missense probably damaging 0.99
PIT4305001:Gsap UTSW 5 21186409 missense probably damaging 0.98
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0012:Gsap UTSW 5 21226229 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0019:Gsap UTSW 5 21270622 splice site probably benign
R0045:Gsap UTSW 5 21226832 missense possibly damaging 0.77
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0054:Gsap UTSW 5 21250935 splice site probably benign
R0409:Gsap UTSW 5 21222445 splice site probably benign
R0507:Gsap UTSW 5 21269963 missense possibly damaging 0.75
R0624:Gsap UTSW 5 21253951 splice site probably null
R1037:Gsap UTSW 5 21251165 splice site probably benign
R1076:Gsap UTSW 5 21287694 missense possibly damaging 0.75
R1459:Gsap UTSW 5 21207238 splice site probably benign
R1757:Gsap UTSW 5 21281037 missense probably damaging 0.98
R1852:Gsap UTSW 5 21290545 splice site probably null
R2034:Gsap UTSW 5 21270595 missense probably damaging 1.00
R2069:Gsap UTSW 5 21226839 splice site probably benign
R2125:Gsap UTSW 5 21242813 missense probably damaging 1.00
R2172:Gsap UTSW 5 21222440 critical splice donor site probably null
R2310:Gsap UTSW 5 21196090 nonsense probably null
R2337:Gsap UTSW 5 21288630 missense probably damaging 1.00
R3442:Gsap UTSW 5 21278127 missense probably damaging 1.00
R4229:Gsap UTSW 5 21246977 missense probably benign 0.00
R4271:Gsap UTSW 5 21226350 critical splice donor site probably null
R4551:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4553:Gsap UTSW 5 21290571 missense probably damaging 1.00
R4649:Gsap UTSW 5 21226311 missense probably damaging 1.00
R4687:Gsap UTSW 5 21246971 utr 3 prime probably benign
R4799:Gsap UTSW 5 21250943 missense probably benign 0.05
R4857:Gsap UTSW 5 21287799 splice site probably null
R4973:Gsap UTSW 5 21254039 missense probably benign 0.04
R5015:Gsap UTSW 5 21222408 missense probably damaging 1.00
R5031:Gsap UTSW 5 21242826 missense possibly damaging 0.57
R5120:Gsap UTSW 5 21269936 missense probably damaging 0.96
R5451:Gsap UTSW 5 21217447 missense probably damaging 1.00
R5469:Gsap UTSW 5 21290544 missense possibly damaging 0.92
R5519:Gsap UTSW 5 21289859 missense probably damaging 1.00
R5588:Gsap UTSW 5 21251149 missense probably damaging 1.00
R6064:Gsap UTSW 5 21229225 missense possibly damaging 0.56
R6139:Gsap UTSW 5 21281540 missense probably damaging 1.00
R6148:Gsap UTSW 5 21226325 missense probably damaging 1.00
R6148:Gsap UTSW 5 21270577 missense probably benign 0.39
R6226:Gsap UTSW 5 21217431 missense probably damaging 1.00
R6859:Gsap UTSW 5 21281018 missense probably damaging 0.99
R6977:Gsap UTSW 5 21271221 missense probably damaging 1.00
R6995:Gsap UTSW 5 21271237 missense possibly damaging 0.58
R7013:Gsap UTSW 5 21278110 missense probably benign 0.39
R7159:Gsap UTSW 5 21270620 splice site probably null
R7181:Gsap UTSW 5 21253429 missense probably damaging 1.00
R7234:Gsap UTSW 5 21186435 missense probably benign
R7332:Gsap UTSW 5 21290121 missense probably benign 0.00
R7381:Gsap UTSW 5 21226787 missense probably damaging 0.96
R8047:Gsap UTSW 5 21257868 critical splice acceptor site probably null
R8062:Gsap UTSW 5 21194463 missense probably damaging 1.00
R8126:Gsap UTSW 5 21270012 missense probably benign 0.04
R8219:Gsap UTSW 5 21251115 missense probably benign 0.00
Z1177:Gsap UTSW 5 21251032 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTGACTGAGGTGAGGTCTTC -3'
(R):5'- CCGAGGAAGACTATGCTCAAGC -3'

Sequencing Primer
(F):5'- AGGTCTTCTATTTGGTGATCTGCTC -3'
(R):5'- CTTCTGATCGTCTCAAAGCACTAAG -3'
Posted On2016-11-08