Incidental Mutation 'R5650:Olfr290'
ID441365
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84916418 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 213 (I213N)
Ref Sequence ENSEMBL: ENSMUSP00000149523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073468
AA Change: I213N

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: I213N

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173463
Predicted Effect possibly damaging
Transcript: ENSMUST00000214501
AA Change: I213N

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216184
AA Change: I213N

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216367
AA Change: I213N

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1652:Olfr290 UTSW 7 84916520 missense probably damaging 1.00
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4822:Olfr290 UTSW 7 84916426 missense possibly damaging 0.81
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5708:Olfr290 UTSW 7 84916183 missense possibly damaging 0.56
R6585:Olfr290 UTSW 7 84916462 missense probably damaging 0.99
R7774:Olfr290 UTSW 7 84916531 missense probably damaging 0.97
R8126:Olfr290 UTSW 7 84915906 missense probably damaging 1.00
R8443:Olfr290 UTSW 7 84916579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCAAGGTTCGCTGTGTG -3'
(R):5'- ACCAGGAGAGTGTTGACTGG -3'

Sequencing Primer
(F):5'- GCAGCTGGGTTTCTGAACTCC -3'
(R):5'- CTGGAGGTTGGGCGAATATAG -3'
Posted On2016-11-08