Mutagenetix > Incidental Mutations

Incidental Mutation 'R5650:Tubgcp3'

441369

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp3

Ensembl Gene

ENSMUSG00000000759

Gene Name

tubulin, gamma complex associated protein 3

Synonyms

Spc98p, GCP3

MMRRC Submission

043296-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R5650 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12614277-12672248 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12648670 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 427 (F427S)

Ref Sequence

ENSEMBL: ENSMUSP00000000776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000776
AA Change: F427S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: F427S

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	761	9.5e-124	PFAM
coiled coil region	787	814	N/A	INTRINSIC
low complexity region	821	827	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164774

SMART Domains

Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	361	3.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164861

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167547

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.6%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	T	C	6: 85,620,271	L693P	probably damaging	Het
Ankrd11	T	C	8: 122,887,397	T2524A	probably damaging	Het
Cdr2	A	G	7: 120,958,336	I322T	probably damaging	Het
Cep76	A	T	18: 67,625,066	C385S	probably damaging	Het
Cercam	C	T	2: 29,881,815	S549F	probably damaging	Het
Coro1b	C	T	19: 4,150,611	T209I	possibly damaging	Het
Dlec1	G	T	9: 119,143,594	E1462*	probably null	Het
Dlgap5	C	T	14: 47,411,739	G166D	probably benign	Het
Ep400	C	T	5: 110,695,952		probably null	Het
Fgr	T	G	4: 133,000,222	V478G	probably benign	Het
Fmo9	T	A	1: 166,663,446	I437F	probably damaging	Het
Gabrd	A	T	4: 155,388,624	V64E	probably damaging	Het
Gsap	A	G	5: 21,251,053	Y385C	probably damaging	Het
Hat1	T	C	2: 71,434,034	V272A	probably benign	Het
Helz	T	A	11: 107,595,146	M127K	probably null	Het
Hist1h4d	A	T	13: 23,581,795	N65I	possibly damaging	Het
Hsp90b1	G	A	10: 86,693,503	A310V	probably damaging	Het
Hspa4	T	C	11: 53,265,092	Y662C	probably damaging	Het
Kif7	C	T	7: 79,710,979	R216H	probably damaging	Het
Klhl33	A	G	14: 50,891,828	I648T	probably benign	Het
Knl1	T	A	2: 119,081,550	L1716*	probably null	Het
Lgals9	T	A	11: 78,973,154	N55I	probably damaging	Het
Lmo7	A	T	14: 101,898,674	T606S	probably damaging	Het
Mdn1	A	G	4: 32,667,467		probably null	Het
Mip	A	T	10: 128,226,065	I62F	possibly damaging	Het
Naa35	G	A	13: 59,622,866		probably benign	Het
Npepl1	T	C	2: 174,121,536	F454L	possibly damaging	Het
Oit1	A	T	14: 8,357,142	V96E	probably damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr50	T	A	2: 36,793,265	S10T	probably benign	Het
Olfr63	A	T	17: 33,268,884	E53D	probably benign	Het
Olfr904	A	T	9: 38,464,727	K229*	probably null	Het
Oxct1	T	A	15: 4,142,850	V466D	probably damaging	Het
Piezo2	T	A	18: 63,011,721	I2768F	probably damaging	Het
Pitpnm1	C	A	19: 4,103,319	D158E	possibly damaging	Het
Plekho2	T	C	9: 65,556,736	N277S	probably benign	Het
Rab33b	T	C	3: 51,493,416	Y104H	probably damaging	Het
Rpap1	T	C	2: 119,773,850	S473G	probably benign	Het
Serpina1b	T	A	12: 103,728,435		probably null	Het
Slc25a17	A	T	15: 81,329,176		probably null	Het
Slc43a2	T	C	11: 75,545,807	C160R	probably damaging	Het
Slc7a4	G	T	16: 17,575,684	L84M	possibly damaging	Het
Slco1a4	T	A	6: 141,809,394	I561F	possibly damaging	Het
Sowahc	GGGAGGAGGAGGAGGAGGAGGAGGAGGA	GGGAGGAGGAGGAGGAGGAGGAGGA	10: 59,223,491		probably benign	Het
Specc1	T	C	11: 62,117,967	I183T	probably damaging	Het
Sucla2	A	G	14: 73,591,129	K362E	probably benign	Het
Tcf12	A	T	9: 71,885,302		probably null	Het
Tlr11	C	T	14: 50,361,201	P215S	probably benign	Het
Tmem41b	A	G	7: 109,974,865	S198P	probably damaging	Het
Wdr81	T	A	11: 75,444,748	S1752C	probably damaging	Het
Zbtb7a	A	G	10: 81,145,049	Y359C	probably damaging	Het
Zfp37	T	C	4: 62,191,765	Y354C	probably damaging	Het
Zmpste24	T	A	4: 121,082,877	I191F	possibly damaging	Het

Other mutations in Tubgcp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Tubgcp3	APN	8	12621809	missense	probably benign	0.00
IGL00583:Tubgcp3	APN	8	12621906	nonsense	probably null
IGL01289:Tubgcp3	APN	8	12639625	missense	probably damaging	1.00
IGL01578:Tubgcp3	APN	8	12661297	splice site	probably benign
IGL01716:Tubgcp3	APN	8	12641094	splice site	probably benign
IGL01943:Tubgcp3	APN	8	12654301	missense	probably damaging	1.00
IGL02020:Tubgcp3	APN	8	12637780	missense	possibly damaging	0.46
IGL02345:Tubgcp3	APN	8	12625056	missense	probably damaging	1.00
IGL02555:Tubgcp3	APN	8	12639595	missense	probably benign	0.36
IGL02644:Tubgcp3	APN	8	12648733	missense	probably damaging	1.00
IGL02976:Tubgcp3	APN	8	12632300	missense	probably damaging	1.00
IGL03240:Tubgcp3	APN	8	12649797	missense	probably benign	0.07
IGL03287:Tubgcp3	APN	8	12639630	missense	possibly damaging	0.77
Tinky_winky	UTSW	8	12650171	missense	probably damaging	1.00
R0145:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01
R0379:Tubgcp3	UTSW	8	12641116	missense	probably damaging	0.97
R0558:Tubgcp3	UTSW	8	12653462	missense	probably benign	0.00
R1490:Tubgcp3	UTSW	8	12639550	missense	probably damaging	1.00
R1709:Tubgcp3	UTSW	8	12639532	nonsense	probably null
R1768:Tubgcp3	UTSW	8	12649686	unclassified	probably benign
R1921:Tubgcp3	UTSW	8	12621932	nonsense	probably null
R1928:Tubgcp3	UTSW	8	12663988	missense	possibly damaging	0.94
R2161:Tubgcp3	UTSW	8	12632292	missense	probably benign	0.22
R3120:Tubgcp3	UTSW	8	12657626	missense	possibly damaging	0.51
R3434:Tubgcp3	UTSW	8	12658381	splice site	probably null
R4011:Tubgcp3	UTSW	8	12639634	nonsense	probably null
R4162:Tubgcp3	UTSW	8	12639547	missense	possibly damaging	0.46
R4300:Tubgcp3	UTSW	8	12657600	missense	probably damaging	0.99
R4350:Tubgcp3	UTSW	8	12641117	missense	probably benign	0.19
R4529:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4530:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4531:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4676:Tubgcp3	UTSW	8	12650171	missense	probably damaging	1.00
R4730:Tubgcp3	UTSW	8	12657654	missense	probably benign	0.03
R4828:Tubgcp3	UTSW	8	12671987	missense	probably benign
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R5610:Tubgcp3	UTSW	8	12639577	missense	probably damaging	1.00
R5625:Tubgcp3	UTSW	8	12624888	missense	possibly damaging	0.46
R5775:Tubgcp3	UTSW	8	12625056	missense	probably damaging	1.00
R6257:Tubgcp3	UTSW	8	12649835	splice site	probably null
R6314:Tubgcp3	UTSW	8	12648625	missense	probably benign	0.02
R6970:Tubgcp3	UTSW	8	12637000	missense	probably damaging	0.98
R7173:Tubgcp3	UTSW	8	12639259	intron	probably null
R7408:Tubgcp3	UTSW	8	12661359	nonsense	probably null
R7502:Tubgcp3	UTSW	8	12641207	missense	probably damaging	0.99
R7701:Tubgcp3	UTSW	8	12655974	missense	probably benign
R7739:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTCATACCTCGCTGAGCTC -3'
(R):5'- GATACACTTTATCTCGCTACTTGG -3'

Sequencing Primer
(F):5'- TCCCAGCACTGACCCTG -3'
(R):5'- CGCTACTTGGCTGTCTTTGCTTAG -3'

Posted On

2016-11-08