Incidental Mutation 'R5650:Tubgcp3'
ID441369
Institutional Source Beutler Lab
Gene Symbol Tubgcp3
Ensembl Gene ENSMUSG00000000759
Gene Nametubulin, gamma complex associated protein 3
SynonymsSpc98p, GCP3
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location12614277-12672248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12648670 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 427 (F427S)
Ref Sequence ENSEMBL: ENSMUSP00000000776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]
Predicted Effect probably damaging
Transcript: ENSMUST00000000776
AA Change: F427S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: F427S

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 761 9.5e-124 PFAM
coiled coil region 787 814 N/A INTRINSIC
low complexity region 821 827 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164774
SMART Domains Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 361 3.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167547
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Tubgcp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Tubgcp3 APN 8 12621809 missense probably benign 0.00
IGL00583:Tubgcp3 APN 8 12621906 nonsense probably null
IGL01289:Tubgcp3 APN 8 12639625 missense probably damaging 1.00
IGL01578:Tubgcp3 APN 8 12661297 splice site probably benign
IGL01716:Tubgcp3 APN 8 12641094 splice site probably benign
IGL01943:Tubgcp3 APN 8 12654301 missense probably damaging 1.00
IGL02020:Tubgcp3 APN 8 12637780 missense possibly damaging 0.46
IGL02345:Tubgcp3 APN 8 12625056 missense probably damaging 1.00
IGL02555:Tubgcp3 APN 8 12639595 missense probably benign 0.36
IGL02644:Tubgcp3 APN 8 12648733 missense probably damaging 1.00
IGL02976:Tubgcp3 APN 8 12632300 missense probably damaging 1.00
IGL03240:Tubgcp3 APN 8 12649797 missense probably benign 0.07
IGL03287:Tubgcp3 APN 8 12639630 missense possibly damaging 0.77
Tinky_winky UTSW 8 12650171 missense probably damaging 1.00
R0145:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R0379:Tubgcp3 UTSW 8 12641116 missense probably damaging 0.97
R0558:Tubgcp3 UTSW 8 12653462 missense probably benign 0.00
R1490:Tubgcp3 UTSW 8 12639550 missense probably damaging 1.00
R1709:Tubgcp3 UTSW 8 12639532 nonsense probably null
R1768:Tubgcp3 UTSW 8 12649686 unclassified probably benign
R1921:Tubgcp3 UTSW 8 12621932 nonsense probably null
R1928:Tubgcp3 UTSW 8 12663988 missense possibly damaging 0.94
R2161:Tubgcp3 UTSW 8 12632292 missense probably benign 0.22
R3120:Tubgcp3 UTSW 8 12657626 missense possibly damaging 0.51
R3434:Tubgcp3 UTSW 8 12658381 splice site probably null
R4011:Tubgcp3 UTSW 8 12639634 nonsense probably null
R4162:Tubgcp3 UTSW 8 12639547 missense possibly damaging 0.46
R4300:Tubgcp3 UTSW 8 12657600 missense probably damaging 0.99
R4350:Tubgcp3 UTSW 8 12641117 missense probably benign 0.19
R4529:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4530:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4531:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4676:Tubgcp3 UTSW 8 12650171 missense probably damaging 1.00
R4730:Tubgcp3 UTSW 8 12657654 missense probably benign 0.03
R4828:Tubgcp3 UTSW 8 12671987 missense probably benign
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R5610:Tubgcp3 UTSW 8 12639577 missense probably damaging 1.00
R5625:Tubgcp3 UTSW 8 12624888 missense possibly damaging 0.46
R5775:Tubgcp3 UTSW 8 12625056 missense probably damaging 1.00
R6257:Tubgcp3 UTSW 8 12649835 splice site probably null
R6314:Tubgcp3 UTSW 8 12648625 missense probably benign 0.02
R6970:Tubgcp3 UTSW 8 12637000 missense probably damaging 0.98
R7173:Tubgcp3 UTSW 8 12639259 intron probably null
R7408:Tubgcp3 UTSW 8 12661359 nonsense probably null
R7502:Tubgcp3 UTSW 8 12641207 missense probably damaging 0.99
R7701:Tubgcp3 UTSW 8 12655974 missense probably benign
R7739:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCATACCTCGCTGAGCTC -3'
(R):5'- GATACACTTTATCTCGCTACTTGG -3'

Sequencing Primer
(F):5'- TCCCAGCACTGACCCTG -3'
(R):5'- CGCTACTTGGCTGTCTTTGCTTAG -3'
Posted On2016-11-08