Incidental Mutation 'R5650:Tcf12'
ID441373
Institutional Source Beutler Lab
Gene Symbol Tcf12
Ensembl Gene ENSMUSG00000032228
Gene Nametranscription factor 12
SynonymsHTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71842688-72111871 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 71885302 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034755] [ENSMUST00000034755] [ENSMUST00000183404] [ENSMUST00000183492] [ENSMUST00000183492] [ENSMUST00000183594] [ENSMUST00000183918] [ENSMUST00000183992] [ENSMUST00000183992] [ENSMUST00000184072] [ENSMUST00000184072] [ENSMUST00000184107] [ENSMUST00000184416] [ENSMUST00000184448] [ENSMUST00000184448] [ENSMUST00000184523] [ENSMUST00000184523] [ENSMUST00000184783] [ENSMUST00000184783] [ENSMUST00000184867] [ENSMUST00000185117] [ENSMUST00000185117]
Predicted Effect probably null
Transcript: ENSMUST00000034755
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034755
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183404
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183492
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183492
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183594
Predicted Effect probably benign
Transcript: ENSMUST00000183647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183784
Predicted Effect probably null
Transcript: ENSMUST00000183918
SMART Domains Protein: ENSMUSP00000138978
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 388 402 N/A INTRINSIC
HLH 437 490 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183992
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183992
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184029
Predicted Effect probably null
Transcript: ENSMUST00000184029
Predicted Effect probably null
Transcript: ENSMUST00000184072
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184072
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184107
Predicted Effect probably benign
Transcript: ENSMUST00000184378
Predicted Effect probably benign
Transcript: ENSMUST00000184416
Predicted Effect probably null
Transcript: ENSMUST00000184448
SMART Domains Protein: ENSMUSP00000139334
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
HLH 413 466 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184448
SMART Domains Protein: ENSMUSP00000139334
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
low complexity region 182 193 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
HLH 413 466 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184523
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184523
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184770
Predicted Effect probably null
Transcript: ENSMUST00000184783
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184783
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184867
Predicted Effect probably null
Transcript: ENSMUST00000185117
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185117
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Tcf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Beneath UTSW 9 71883103 splice site probably null
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
R7146:Tcf12 UTSW 9 71883103 splice site probably null
R7734:Tcf12 UTSW 9 71922661 missense probably benign 0.00
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCACTGCCTGAATTTGTG -3'
(R):5'- ATATGGTGGAGTTGAAAGTGTACC -3'

Sequencing Primer
(F):5'- ACTGCCTGAATTTGTGCACAG -3'
(R):5'- AGAGATAAGATAGACCTTCTTTG -3'
Posted On2016-11-08