Incidental Mutation 'R5650:Wdr81'
ID441381
Institutional Source Beutler Lab
Gene Symbol Wdr81
Ensembl Gene ENSMUSG00000045374
Gene NameWD repeat domain 81
SynonymsMGC32441
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75440944-75454717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75444748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1752 (S1752C)
Ref Sequence ENSEMBL: ENSMUSP00000134266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173320]
Predicted Effect unknown
Transcript: ENSMUST00000117392
AA Change: S1751C
SMART Domains Protein: ENSMUSP00000113939
Gene: ENSMUSG00000045374
AA Change: S1751C

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132442
AA Change: S633C
SMART Domains Protein: ENSMUSP00000120605
Gene: ENSMUSG00000045374
AA Change: S633C

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 23 47 N/A INTRINSIC
low complexity region 78 92 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
WD40 512 551 3.19e-7 SMART
WD40 561 598 1.18e2 SMART
WD40 601 670 3.55e1 SMART
Blast:WD40 673 710 3e-14 BLAST
WD40 715 756 4.26e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135804
Predicted Effect probably damaging
Transcript: ENSMUST00000173320
AA Change: S1752C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134266
Gene: ENSMUSG00000045374
AA Change: S1752C

DomainStartEndE-ValueType
Beach 347 589 2.52e-98 SMART
low complexity region 673 704 N/A INTRINSIC
low complexity region 848 874 N/A INTRINSIC
low complexity region 1141 1165 N/A INTRINSIC
low complexity region 1196 1210 N/A INTRINSIC
low complexity region 1566 1587 N/A INTRINSIC
WD40 1630 1669 3.19e-7 SMART
WD40 1679 1716 1.18e2 SMART
WD40 1719 1761 7.36e1 SMART
WD40 1764 1807 3.3e1 SMART
WD40 1810 1848 3.58e-1 SMART
WD40 1893 1934 4.26e1 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain transmembrane protein, which is predominantly expressed in the brain. Mutations in this gene are associated with autosomal recessive cerebellar ataxia, mental retardation, and dysequilibrium syndrome-2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit weight loss, tremors, ataxia and an abnormal gait, as well as abnormal mitochondria in Purkinje cell dendrites, Purkinje cell degeneration, photoreceptor cell loss, and decreased total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Wdr81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Wdr81 APN 11 75445601 missense probably damaging 1.00
IGL02047:Wdr81 APN 11 75445506 missense probably damaging 1.00
IGL02103:Wdr81 APN 11 75444720 missense probably damaging 1.00
IGL02506:Wdr81 APN 11 75444406 missense probably benign 0.44
jello UTSW 11 75441812 missense probably damaging 1.00
R1184:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R1560:Wdr81 UTSW 11 75451623 nonsense probably null
R1680:Wdr81 UTSW 11 75454423 missense probably benign
R1689:Wdr81 UTSW 11 75445596 missense probably damaging 0.99
R2021:Wdr81 UTSW 11 75445962 nonsense probably null
R2104:Wdr81 UTSW 11 75452983 missense probably damaging 1.00
R2113:Wdr81 UTSW 11 75453635 missense probably benign 0.07
R2198:Wdr81 UTSW 11 75446081 missense probably benign 0.00
R2393:Wdr81 UTSW 11 75449405 missense probably damaging 1.00
R2400:Wdr81 UTSW 11 75449035 missense probably benign
R2850:Wdr81 UTSW 11 75451172 missense probably damaging 1.00
R3410:Wdr81 UTSW 11 75452932 missense probably damaging 0.97
R3764:Wdr81 UTSW 11 75452803 missense probably damaging 1.00
R4223:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R4351:Wdr81 UTSW 11 75441812 missense probably damaging 1.00
R4594:Wdr81 UTSW 11 75445794 missense probably benign 0.00
R4601:Wdr81 UTSW 11 75445658 missense probably damaging 1.00
R4647:Wdr81 UTSW 11 75445988 missense probably damaging 0.98
R4651:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4652:Wdr81 UTSW 11 75451240 missense probably damaging 0.99
R4930:Wdr81 UTSW 11 75451924 missense probably benign
R4966:Wdr81 UTSW 11 75445949 missense probably benign 0.34
R5075:Wdr81 UTSW 11 75452481 missense probably benign 0.00
R5412:Wdr81 UTSW 11 75450794 missense probably null 1.00
R5426:Wdr81 UTSW 11 75450896 missense possibly damaging 0.87
R5540:Wdr81 UTSW 11 75449070 missense probably damaging 1.00
R5544:Wdr81 UTSW 11 75441797 missense probably damaging 1.00
R5632:Wdr81 UTSW 11 75445906 missense probably damaging 0.99
R5679:Wdr81 UTSW 11 75452923 missense probably damaging 1.00
R5978:Wdr81 UTSW 11 75444398 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6031:Wdr81 UTSW 11 75447869 missense probably damaging 1.00
R6412:Wdr81 UTSW 11 75451163 missense probably benign 0.16
R6479:Wdr81 UTSW 11 75452105 missense possibly damaging 0.92
R6992:Wdr81 UTSW 11 75451786 missense probably benign 0.00
R7148:Wdr81 UTSW 11 75446002 missense
R7340:Wdr81 UTSW 11 75444699 missense probably null
R7739:Wdr81 UTSW 11 75441985 missense
R7823:Wdr81 UTSW 11 75449801 missense probably damaging 1.00
R7898:Wdr81 UTSW 11 75453899 missense probably benign
R7938:Wdr81 UTSW 11 75448002 missense probably benign 0.00
R8425:Wdr81 UTSW 11 75451522 missense possibly damaging 0.93
Z1176:Wdr81 UTSW 11 75449885 missense
Z1176:Wdr81 UTSW 11 75451947 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGAAAAGCCCCATCCGTG -3'
(R):5'- GAAAGCCCTGAGATTGTGTTTTC -3'

Sequencing Primer
(F):5'- CTTTCCTGACTGGTACCTAG -3'
(R):5'- TCACTGGGGAATGGGATGC -3'
Posted On2016-11-08