Incidental Mutation 'R5650:Serpina1b'
ID441385
Institutional Source Beutler Lab
Gene Symbol Serpina1b
Ensembl Gene ENSMUSG00000071178
Gene Nameserine (or cysteine) preptidase inhibitor, clade A, member 1B
SynonymsPI2, D12Ucla2, Spi1-2
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103728156-103830373 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 103728435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095450] [ENSMUST00000164454] [ENSMUST00000164454] [ENSMUST00000186166] [ENSMUST00000186166] [ENSMUST00000187220]
Predicted Effect probably null
Transcript: ENSMUST00000095450
SMART Domains Protein: ENSMUSP00000093101
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186166
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably null
Transcript: ENSMUST00000186166
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187220
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted disruption of this gene leads to significantly fewer than expected heterozygous and homozygous offspring from heterozygous matings. Homozygotes are healthy with no obvious changes in major organs while heterozygotes show a 30% decrease in serum anti-elastase and anti-chymotrypsin activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Serpina1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Serpina1b APN 12 103729296 missense possibly damaging 0.90
IGL00990:Serpina1b APN 12 103728266 missense probably damaging 1.00
IGL01947:Serpina1b APN 12 103729317 missense probably benign 0.00
IGL03258:Serpina1b APN 12 103730396 missense probably benign 0.00
IGL03392:Serpina1b APN 12 103732070 missense possibly damaging 0.53
R1937:Serpina1b UTSW 12 103732161 missense probably benign 0.00
R2383:Serpina1b UTSW 12 103728280 missense probably benign
R3789:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R4690:Serpina1b UTSW 12 103732380 missense probably damaging 1.00
R5164:Serpina1b UTSW 12 103732087 missense probably benign 0.01
R6017:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R6241:Serpina1b UTSW 12 103729256 unclassified probably null
R6522:Serpina1b UTSW 12 103735037 unclassified probably null
R6745:Serpina1b UTSW 12 103730355 missense possibly damaging 0.60
R6884:Serpina1b UTSW 12 103732453 missense probably benign 0.00
R7053:Serpina1b UTSW 12 103732429 missense possibly damaging 0.93
R7208:Serpina1b UTSW 12 103728294 missense probably benign 0.04
R7679:Serpina1b UTSW 12 103730515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTTCCCACAAAGATGGG -3'
(R):5'- ATCCCAGGCCATGAGAGATG -3'

Sequencing Primer
(F):5'- CCACAAAGATGGGGCTCTG -3'
(R):5'- AATGGACCAAGGCAGGC -3'
Posted On2016-11-08