Incidental Mutation 'R5650:Hist1h4d'
ID441386
Institutional Source Beutler Lab
Gene Symbol Hist1h4d
Ensembl Gene ENSMUSG00000061482
Gene Namehistone cluster 1, H4d
Synonyms
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23581598-23582735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23581795 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 65 (N65I)
Ref Sequence ENSEMBL: ENSMUSP00000100033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000091704] [ENSMUST00000102968] [ENSMUST00000105105]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102968
AA Change: N65I

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100033
Gene: ENSMUSG00000061482
AA Change: N65I

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Hist1h4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2318:Hist1h4d UTSW 13 23581756 missense probably damaging 1.00
R5558:Hist1h4d UTSW 13 23581796 missense possibly damaging 0.92
R5753:Hist1h4d UTSW 13 23581604 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GTTTGCTAACATGTCTGGACGC -3'
(R):5'- GCAGCTCCTTTAAGTGAGAAGG -3'

Sequencing Primer
(F):5'- CATGTCTGGACGCGGGAAAG -3'
(R):5'- CCTTTAAGTGAGAAGGTAGTGGCCC -3'
Posted On2016-11-08