Incidental Mutation 'R5650:Sucla2'
ID441393
Institutional Source Beutler Lab
Gene Symbol Sucla2
Ensembl Gene ENSMUSG00000022110
Gene Namesuccinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms4930547K18Rik
MMRRC Submission 043296-MU
Accession Numbers

Genbank: NM_011506; MGI: 1306775

Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73525319-73596142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73591129 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 362 (K362E)
Ref Sequence ENSEMBL: ENSMUSP00000123765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022706] [ENSMUST00000160507]
Predicted Effect probably benign
Transcript: ENSMUST00000022706
AA Change: K362E

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022706
Gene: ENSMUSG00000022110
AA Change: K362E

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 1.6e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.2e-78 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159165
Predicted Effect probably benign
Transcript: ENSMUST00000160507
AA Change: K362E

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123765
Gene: ENSMUSG00000022110
AA Change: K362E

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 3e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.5e-77 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161082
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit perinatal lethality with reduced size, placenta mineralization, decreased mitochondrial DNA and respiration. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Sucla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sucla2 APN 14 73590907 missense possibly damaging 0.81
IGL01539:Sucla2 APN 14 73591121 missense probably damaging 0.97
IGL02064:Sucla2 APN 14 73579473 nonsense probably null
IGL02240:Sucla2 APN 14 73590847 missense probably damaging 1.00
IGL02640:Sucla2 APN 14 73581806 missense probably benign 0.45
IGL02965:Sucla2 APN 14 73579431 missense probably benign 0.00
3-1:Sucla2 UTSW 14 73568957 nonsense probably null
PIT4812001:Sucla2 UTSW 14 73579449 missense possibly damaging 0.89
R0189:Sucla2 UTSW 14 73592648 missense probably damaging 1.00
R0764:Sucla2 UTSW 14 73560634 unclassified probably benign
R0765:Sucla2 UTSW 14 73560634 unclassified probably benign
R0844:Sucla2 UTSW 14 73560634 unclassified probably benign
R1065:Sucla2 UTSW 14 73560634 unclassified probably benign
R1067:Sucla2 UTSW 14 73560634 unclassified probably benign
R1136:Sucla2 UTSW 14 73560634 unclassified probably benign
R1162:Sucla2 UTSW 14 73560634 unclassified probably benign
R1311:Sucla2 UTSW 14 73560634 unclassified probably benign
R1312:Sucla2 UTSW 14 73560634 unclassified probably benign
R1345:Sucla2 UTSW 14 73560634 unclassified probably benign
R1416:Sucla2 UTSW 14 73560634 unclassified probably benign
R1677:Sucla2 UTSW 14 73592681 missense probably damaging 1.00
R1968:Sucla2 UTSW 14 73593679 missense probably damaging 0.99
R2126:Sucla2 UTSW 14 73592668 missense possibly damaging 0.71
R2484:Sucla2 UTSW 14 73581709 missense probably benign 0.12
R2566:Sucla2 UTSW 14 73552804 intron probably benign
R3706:Sucla2 UTSW 14 73591052 missense probably damaging 1.00
R4725:Sucla2 UTSW 14 73568989 missense possibly damaging 0.94
R5620:Sucla2 UTSW 14 73595396 missense probably damaging 0.99
R5947:Sucla2 UTSW 14 73592669 missense probably damaging 1.00
R6045:Sucla2 UTSW 14 73568964 nonsense probably null
R6236:Sucla2 UTSW 14 73593750 missense probably benign 0.39
R6693:Sucla2 UTSW 14 73568667 nonsense probably null
R7706:Sucla2 UTSW 14 73568993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATAGGATGTCTAGGTACCCAG -3'
(R):5'- TGAATGGCTCCCATGTCAGTC -3'

Sequencing Primer
(F):5'- TCTAGGTACCCAGTGTATTTTCATG -3'
(R):5'- TCCCATGTCAGTCCACAATAGG -3'
Posted On2016-11-08