Incidental Mutation 'R5650:Olfr63'
ID441399
Institutional Source Beutler Lab
Gene Symbol Olfr63
Ensembl Gene ENSMUSG00000054666
Gene Nameolfactory receptor 63
SynonymsGA_x6K02T2NTC5-9778-8828, M4, MOR267-1
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33264676-33275644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33268884 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 53 (E53D)
Ref Sequence ENSEMBL: ENSMUSP00000150323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067840] [ENSMUST00000217023]
Predicted Effect probably benign
Transcript: ENSMUST00000067840
AA Change: E53D

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000067207
Gene: ENSMUSG00000054666
AA Change: E53D

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7tm_1 42 288 5.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215466
Predicted Effect probably benign
Transcript: ENSMUST00000217023
AA Change: E53D

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Slco1a4 T A 6: 141,809,394 I561F possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Olfr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr63 APN 17 33269655 missense probably benign 0.00
IGL02313:Olfr63 APN 17 33269665 missense probably benign
IGL02639:Olfr63 APN 17 33269395 missense possibly damaging 0.96
IGL02851:Olfr63 APN 17 33269354 missense probably benign 0.01
IGL03007:Olfr63 APN 17 33268883 missense probably damaging 0.98
IGL03206:Olfr63 APN 17 33268751 missense possibly damaging 0.46
R0143:Olfr63 UTSW 17 33269497 missense probably damaging 1.00
R0355:Olfr63 UTSW 17 33269135 missense probably damaging 0.98
R1115:Olfr63 UTSW 17 33268966 nonsense probably null
R1117:Olfr63 UTSW 17 33268966 nonsense probably null
R1567:Olfr63 UTSW 17 33269476 missense probably benign
R1986:Olfr63 UTSW 17 33269515 missense probably benign 0.00
R3905:Olfr63 UTSW 17 33268775 missense probably damaging 1.00
R4612:Olfr63 UTSW 17 33269480 missense probably benign 0.20
R5855:Olfr63 UTSW 17 33269336 missense possibly damaging 0.81
R6712:Olfr63 UTSW 17 33269268 missense possibly damaging 0.76
R7873:Olfr63 UTSW 17 33269374 missense probably benign
X0026:Olfr63 UTSW 17 33269050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCCAGAGCTGTATTTTCATTG -3'
(R):5'- ACATAGCGGTCATAGCCCATG -3'

Sequencing Primer
(F):5'- TGATCTCATCAGCCTCAGGAG -3'
(R):5'- CCATGACCACGAGCAGG -3'
Posted On2016-11-08