Mutagenetix > Incidental Mutations

Incidental Mutation 'R5651:Brinp3'

441407

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

043297-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R5651 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146701799 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 191 (T191S)

Ref Sequence

ENSEMBL: ENSMUSP00000118552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

Predicted Effect

probably benign
Transcript: ENSMUST00000074622
AA Change: T191S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: T191S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132847
AA Change: T191S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131
AA Change: T191S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166814
AA Change: T191S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: T191S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	A	11: 49,019,873	H578Y	probably damaging	Het
Atp11b	A	G	3: 35,855,140	D1161G	probably damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
AY358078	T	A	14: 51,822,160	V318D	unknown	Het
B020004C17Rik	C	T	14: 57,015,232		probably benign	Het
Boc	T	A	16: 44,521,195	I16F	probably benign	Het
Cald1	T	A	6: 34,762,320	N419K	probably damaging	Het
Cecr2	G	A	6: 120,755,560	G471D	probably damaging	Het
Cftr	T	A	6: 18,255,365		probably null	Het
Cyp2c38	T	A	19: 39,460,712	T66S	probably damaging	Het
Dirc2	G	A	16: 35,735,616	A158V	probably benign	Het
Fam212b	C	A	3: 105,716,432	Q22K	probably damaging	Het
Fbxo11	A	T	17: 88,015,708	D83E	probably benign	Het
Fshr	T	A	17: 88,985,829	M474L	possibly damaging	Het
Hhla1	T	A	15: 65,941,814	E223V	probably damaging	Het
Hnrnpa1	G	C	15: 103,240,528	E5D	possibly damaging	Het
Htr2a	T	A	14: 74,705,703	V241E	probably damaging	Het
Ier5	T	C	1: 155,098,745	E229G	possibly damaging	Het
Krt87	A	T	15: 101,434,029	M276K	possibly damaging	Het
Mast1	G	C	8: 84,928,968	Y182*	probably null	Het
Mia3	T	A	1: 183,358,654	D239V	probably damaging	Het
Mpp7	A	G	18: 7,355,016		probably null	Het
Mut	T	A	17: 40,947,111	D389E	probably damaging	Het
Mycbp2	A	G	14: 103,282,665	C739R	probably null	Het
Olfr1053	A	G	2: 86,314,440	I282T	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr311	A	T	11: 58,841,491	R126*	probably null	Het
Olfr70	C	G	4: 43,696,636	C179S	probably damaging	Het
Palld	A	T	8: 61,538,788	I510N	probably damaging	Het
Pappa	A	G	4: 65,156,352	E381G	probably damaging	Het
Phldb1	G	A	9: 44,711,903	T618I	probably damaging	Het
Pkd1	A	G	17: 24,591,387	E3631G	possibly damaging	Het
Pkhd1	C	T	1: 20,117,807	V3426I	probably benign	Het
Plk4	A	G	3: 40,813,505	T828A	probably benign	Het
Psmb5	C	T	14: 54,616,764	A86T	possibly damaging	Het
Rasal2	A	G	1: 157,157,381	V907A	probably damaging	Het
Rxra	C	T	2: 27,737,341	T24M	probably benign	Het
Senp1	A	G	15: 98,076,617	S105P	probably benign	Het
Sh3rf1	A	G	8: 61,363,167	D486G	probably damaging	Het
Slfn5	A	C	11: 82,960,664	N596H	probably benign	Het
Tanc2	T	A	11: 105,798,700	D229E	probably benign	Het
Taok2	T	C	7: 126,880,283	K57E	probably damaging	Het
Thsd7a	C	T	6: 12,343,213	C1135Y	probably damaging	Het
V1ra8	T	C	6: 90,203,526	L237P	probably benign	Het
Vcpip1	G	A	1: 9,747,840	T106M	probably damaging	Het
Vmn1r215	T	G	13: 23,075,811	I7S	possibly damaging	Het
Vmn1r233	T	A	17: 20,994,017	M224L	probably benign	Het
Xpot	A	T	10: 121,604,549	D592E	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAGGCACTCTTTCTTGGCGATAAG -3'
(R):5'- TCAAGAGACTTGAGGCTCCAG -3'

Sequencing Primer
(F):5'- CACTCTTTCTTGGCGATAAGTATAAG -3'
(R):5'- CTTGAGGCTCCAGGGAAGG -3'

Posted On

2016-11-08