Mutagenetix > Incidental Mutations

Incidental Mutation 'R5651:Cecr2'

441422

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

043297-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5651 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 120755560 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 471 (G471D)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100993
AA Change: G471D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: G471D

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112686
AA Change: G471D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: G471D

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143563

SMART Domains

Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	114	131	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik2	G	A	11: 49,019,873	H578Y	probably damaging	Het
Atp11b	A	G	3: 35,855,140	D1161G	probably damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
AY358078	T	A	14: 51,822,160	V318D	unknown	Het
B020004C17Rik	C	T	14: 57,015,232		probably benign	Het
Boc	T	A	16: 44,521,195	I16F	probably benign	Het
Brinp3	A	T	1: 146,701,799	T191S	probably benign	Het
Cald1	T	A	6: 34,762,320	N419K	probably damaging	Het
Cftr	T	A	6: 18,255,365		probably null	Het
Cyp2c38	T	A	19: 39,460,712	T66S	probably damaging	Het
Dirc2	G	A	16: 35,735,616	A158V	probably benign	Het
Fam212b	C	A	3: 105,716,432	Q22K	probably damaging	Het
Fbxo11	A	T	17: 88,015,708	D83E	probably benign	Het
Fshr	T	A	17: 88,985,829	M474L	possibly damaging	Het
Hhla1	T	A	15: 65,941,814	E223V	probably damaging	Het
Hnrnpa1	G	C	15: 103,240,528	E5D	possibly damaging	Het
Htr2a	T	A	14: 74,705,703	V241E	probably damaging	Het
Ier5	T	C	1: 155,098,745	E229G	possibly damaging	Het
Krt87	A	T	15: 101,434,029	M276K	possibly damaging	Het
Mast1	G	C	8: 84,928,968	Y182*	probably null	Het
Mia3	T	A	1: 183,358,654	D239V	probably damaging	Het
Mpp7	A	G	18: 7,355,016		probably null	Het
Mut	T	A	17: 40,947,111	D389E	probably damaging	Het
Mycbp2	A	G	14: 103,282,665	C739R	probably null	Het
Olfr1053	A	G	2: 86,314,440	I282T	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr311	A	T	11: 58,841,491	R126*	probably null	Het
Olfr70	C	G	4: 43,696,636	C179S	probably damaging	Het
Palld	A	T	8: 61,538,788	I510N	probably damaging	Het
Pappa	A	G	4: 65,156,352	E381G	probably damaging	Het
Phldb1	G	A	9: 44,711,903	T618I	probably damaging	Het
Pkd1	A	G	17: 24,591,387	E3631G	possibly damaging	Het
Pkhd1	C	T	1: 20,117,807	V3426I	probably benign	Het
Plk4	A	G	3: 40,813,505	T828A	probably benign	Het
Psmb5	C	T	14: 54,616,764	A86T	possibly damaging	Het
Rasal2	A	G	1: 157,157,381	V907A	probably damaging	Het
Rxra	C	T	2: 27,737,341	T24M	probably benign	Het
Senp1	A	G	15: 98,076,617	S105P	probably benign	Het
Sh3rf1	A	G	8: 61,363,167	D486G	probably damaging	Het
Slfn5	A	C	11: 82,960,664	N596H	probably benign	Het
Tanc2	T	A	11: 105,798,700	D229E	probably benign	Het
Taok2	T	C	7: 126,880,283	K57E	probably damaging	Het
Thsd7a	C	T	6: 12,343,213	C1135Y	probably damaging	Het
V1ra8	T	C	6: 90,203,526	L237P	probably benign	Het
Vcpip1	G	A	1: 9,747,840	T106M	probably damaging	Het
Vmn1r215	T	G	13: 23,075,811	I7S	possibly damaging	Het
Vmn1r233	T	A	17: 20,994,017	M224L	probably benign	Het
Xpot	A	T	10: 121,604,549	D592E	probably damaging	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	intron	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGGCATGCAGTTAATTGG -3'
(R):5'- CTTGGACTATAGCAACTCCATCTC -3'

Sequencing Primer
(F):5'- GAGACAAGGCTTCATTTACTATTACC -3'
(R):5'- GGACTATAGCAACTCCATCTCAAAAG -3'

Posted On

2016-11-08