Incidental Mutation 'R5651:Tanc2'
ID441434
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105798700 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 229 (D229E)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably benign
Transcript: ENSMUST00000100330
AA Change: D229E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: D229E

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hhla1 T A 15: 65,941,814 E223V probably damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Htr2a T A 14: 74,705,703 V241E probably damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mut T A 17: 40,947,111 D389E probably damaging Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Pappa A G 4: 65,156,352 E381G probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGGTAAATGGCTGTAGTAACTTTGG -3'
(R):5'- CTCCTAGGTTACACAAAAGAATGAC -3'

Sequencing Primer
(F):5'- ATGGCTGTAGTAACTTTGGAAGATAG -3'
(R):5'- AGGTTACACAAAAGAATGACTTGTC -3'
Posted On2016-11-08