Incidental Mutation 'R5651:Htr2a'
ID441439
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74705703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 241 (V241E)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably damaging
Transcript: ENSMUST00000036653
AA Change: V241E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: V241E

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hhla1 T A 15: 65,941,814 E223V probably damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mut T A 17: 40,947,111 D389E probably damaging Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Pappa A G 4: 65,156,352 E381G probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Tanc2 T A 11: 105,798,700 D229E probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0117:Htr2a UTSW 14 74645093 missense probably damaging 1.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1507:Htr2a UTSW 14 74705979 missense probably damaging 1.00
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3154:Htr2a UTSW 14 74705822 missense probably benign 0.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4006:Htr2a UTSW 14 74642141 missense probably benign
R4007:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGGTGATGCTTGTACCTTC -3'
(R):5'- GATGGACTGCATCGTCCTTC -3'

Sequencing Primer
(F):5'- CATAGTCTCAGTCCCTTGATGG -3'
(R):5'- CCTGGCTCTCTGTGGATGGAC -3'
Posted On2016-11-08