Incidental Mutation 'R5651:Hhla1'
ID441441
Institutional Source Beutler Lab
Gene Symbol Hhla1
Ensembl Gene ENSMUSG00000072511
Gene NameHERV-H LTR-associating 1
SynonymsF930104E18Rik
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65922443-65976804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65941814 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 223 (E223V)
Ref Sequence ENSEMBL: ENSMUSP00000098149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100584]
Predicted Effect probably damaging
Transcript: ENSMUST00000100584
AA Change: E223V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098149
Gene: ENSMUSG00000072511
AA Change: E223V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Htr2a T A 14: 74,705,703 V241E probably damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mut T A 17: 40,947,111 D389E probably damaging Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Pappa A G 4: 65,156,352 E381G probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Tanc2 T A 11: 105,798,700 D229E probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Hhla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Hhla1 APN 15 65941961 missense probably damaging 1.00
IGL02531:Hhla1 APN 15 65967407 splice site probably benign
IGL02609:Hhla1 APN 15 65930614 splice site probably benign
IGL02948:Hhla1 APN 15 65942693 missense probably damaging 1.00
IGL03063:Hhla1 APN 15 65941790 missense probably damaging 1.00
IGL03411:Hhla1 APN 15 65930229 critical splice donor site probably null
encroachment UTSW 15 65948485 missense probably damaging 1.00
trespass UTSW 15 65936382 nonsense probably null
P4717OSA:Hhla1 UTSW 15 65924001 missense probably damaging 0.99
R0277:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0323:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0492:Hhla1 UTSW 15 65936291 missense probably benign
R1546:Hhla1 UTSW 15 65933327 missense probably benign 0.10
R2039:Hhla1 UTSW 15 65936377 missense possibly damaging 0.75
R2112:Hhla1 UTSW 15 65936383 missense probably benign 0.00
R2405:Hhla1 UTSW 15 65936311 nonsense probably null
R4804:Hhla1 UTSW 15 65923099 missense probably benign 0.01
R5512:Hhla1 UTSW 15 65924016 missense probably benign 0.00
R6012:Hhla1 UTSW 15 65948490 missense probably damaging 1.00
R6237:Hhla1 UTSW 15 65941797 missense probably damaging 1.00
R6837:Hhla1 UTSW 15 65948485 missense probably damaging 1.00
R7506:Hhla1 UTSW 15 65936382 nonsense probably null
R7657:Hhla1 UTSW 15 65965459 missense probably damaging 0.99
Z1177:Hhla1 UTSW 15 65941775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACAGGTGTTCCTCACTG -3'
(R):5'- AATCGGACTGTGTCTTCATCTG -3'

Sequencing Primer
(F):5'- TTCCTCACTGGGGAGAAAGGATTC -3'
(R):5'- CATCTGTGTGATGGTGGGAAAGTC -3'
Posted On2016-11-08