Incidental Mutation 'R5651:Mut'
ID441449
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40947111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 389 (D389E)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169611]
Predicted Effect probably damaging
Transcript: ENSMUST00000169611
AA Change: D389E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: D389E

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hhla1 T A 15: 65,941,814 E223V probably damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Htr2a T A 14: 74,705,703 V241E probably damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Pappa A G 4: 65,156,352 E381G probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Tanc2 T A 11: 105,798,700 D229E probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0603:Mut UTSW 17 40947166 missense probably damaging 0.99
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R2448:Mut UTSW 17 40958841 missense probably damaging 0.96
R3113:Mut UTSW 17 40958356 missense probably damaging 1.00
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R3894:Mut UTSW 17 40955139 missense probably damaging 0.97
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5031:Mut UTSW 17 40938827 missense possibly damaging 0.96
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGTCTGATGTTCAATCCACCCC -3'
(R):5'- GTTATAAGGAGGAGAATCTGACCTTC -3'

Sequencing Primer
(F):5'- CCCCAAAGTGCTTTCGAAATTGG -3'
(R):5'- CAGAGCAGCCTCATAAACGTCATTTG -3'
Posted On2016-11-08