Incidental Mutation 'R0078:Mapk3'
ID44145
Institutional Source Beutler Lab
Gene Symbol Mapk3
Ensembl Gene ENSMUSG00000063065
Gene Namemitogen-activated protein kinase 3
Synonymsp44erk1, p44mapk, Prkm3, p44 MAP kinase, Mtap2k, Erk1, Esrk1, Erk-1
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0078 (G1)
Quality Score127
Status Validated
Chromosome7
Chromosomal Location126759601-126765819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126759805 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 54 (Y54H)
Ref Sequence ENSEMBL: ENSMUSP00000101969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050201] [ENSMUST00000057669] [ENSMUST00000091328]
Predicted Effect probably damaging
Transcript: ENSMUST00000050201
AA Change: Y54H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101969
Gene: ENSMUSG00000063065
AA Change: Y54H

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Predicted Effect unknown
Transcript: ENSMUST00000057669
AA Change: Y54H
SMART Domains Protein: ENSMUSP00000051619
Gene: ENSMUSG00000063065
AA Change: Y54H

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
S_TKc 43 331 3.3e-97 SMART
Blast:S_TKc 335 372 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091328
SMART Domains Protein: ENSMUSP00000088880
Gene: ENSMUSG00000063065

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 213 2.5e-24 PFAM
Pfam:Pkinase 1 216 2.2e-58 PFAM
Pfam:APH 17 108 7.6e-7 PFAM
Blast:S_TKc 220 257 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145965
Predicted Effect unknown
Transcript: ENSMUST00000205657
AA Change: Y52H
Predicted Effect probably benign
Transcript: ENSMUST00000206272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206875
Meta Mutation Damage Score 0.5888 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are hyperactive with impaired T cell maturation and proliferation. Mice homozygous for a knock-out allele on a CD-1 background exhibit normal Mendelian ratios, growth, and no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Mapk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mapk3 APN 7 126764774 nonsense probably null
IGL02412:Mapk3 APN 7 126763038 nonsense probably null
wabasha UTSW 7 126763512 nonsense probably null
R0532:Mapk3 UTSW 7 126763386 intron probably benign
R1549:Mapk3 UTSW 7 126763512 nonsense probably null
R2913:Mapk3 UTSW 7 126760806 nonsense probably null
R5220:Mapk3 UTSW 7 126764236 missense probably benign
R5408:Mapk3 UTSW 7 126763835 missense probably damaging 1.00
R5729:Mapk3 UTSW 7 126764807 missense probably benign 0.01
R5929:Mapk3 UTSW 7 126759858 unclassified probably benign
R6307:Mapk3 UTSW 7 126764282 missense probably benign 0.03
R6359:Mapk3 UTSW 7 126760756 missense probably benign
R7356:Mapk3 UTSW 7 126760915 critical splice donor site probably null
R7380:Mapk3 UTSW 7 126764795 missense
R7384:Mapk3 UTSW 7 126764291 missense
X0017:Mapk3 UTSW 7 126764248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGACTAAAGTACCCTAGTGGC -3'
(R):5'- CCCTCCCTTAACAATACAAGGTGGC -3'

Sequencing Primer
(F):5'- cggtgacagggcggtag -3'
(R):5'- AAGGTGGCTTCAAAGCCTC -3'
Posted On2013-06-11