Incidental Mutation 'R5651:Atp8b1'
ID441453
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission 043297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5651 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 64531382 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1238 (I1238M)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably benign
Transcript: ENSMUST00000025482
AA Change: I1238M

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: I1238M

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G A 11: 49,019,873 H578Y probably damaging Het
Atp11b A G 3: 35,855,140 D1161G probably damaging Het
AY358078 T A 14: 51,822,160 V318D unknown Het
B020004C17Rik C T 14: 57,015,232 probably benign Het
Boc T A 16: 44,521,195 I16F probably benign Het
Brinp3 A T 1: 146,701,799 T191S probably benign Het
Cald1 T A 6: 34,762,320 N419K probably damaging Het
Cecr2 G A 6: 120,755,560 G471D probably damaging Het
Cftr T A 6: 18,255,365 probably null Het
Cyp2c38 T A 19: 39,460,712 T66S probably damaging Het
Dirc2 G A 16: 35,735,616 A158V probably benign Het
Fam212b C A 3: 105,716,432 Q22K probably damaging Het
Fbxo11 A T 17: 88,015,708 D83E probably benign Het
Fshr T A 17: 88,985,829 M474L possibly damaging Het
Hhla1 T A 15: 65,941,814 E223V probably damaging Het
Hnrnpa1 G C 15: 103,240,528 E5D possibly damaging Het
Htr2a T A 14: 74,705,703 V241E probably damaging Het
Ier5 T C 1: 155,098,745 E229G possibly damaging Het
Krt87 A T 15: 101,434,029 M276K possibly damaging Het
Mast1 G C 8: 84,928,968 Y182* probably null Het
Mia3 T A 1: 183,358,654 D239V probably damaging Het
Mpp7 A G 18: 7,355,016 probably null Het
Mut T A 17: 40,947,111 D389E probably damaging Het
Mycbp2 A G 14: 103,282,665 C739R probably null Het
Olfr1053 A G 2: 86,314,440 I282T probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr311 A T 11: 58,841,491 R126* probably null Het
Olfr70 C G 4: 43,696,636 C179S probably damaging Het
Palld A T 8: 61,538,788 I510N probably damaging Het
Pappa A G 4: 65,156,352 E381G probably damaging Het
Phldb1 G A 9: 44,711,903 T618I probably damaging Het
Pkd1 A G 17: 24,591,387 E3631G possibly damaging Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Plk4 A G 3: 40,813,505 T828A probably benign Het
Psmb5 C T 14: 54,616,764 A86T possibly damaging Het
Rasal2 A G 1: 157,157,381 V907A probably damaging Het
Rxra C T 2: 27,737,341 T24M probably benign Het
Senp1 A G 15: 98,076,617 S105P probably benign Het
Sh3rf1 A G 8: 61,363,167 D486G probably damaging Het
Slfn5 A C 11: 82,960,664 N596H probably benign Het
Tanc2 T A 11: 105,798,700 D229E probably benign Het
Taok2 T C 7: 126,880,283 K57E probably damaging Het
Thsd7a C T 6: 12,343,213 C1135Y probably damaging Het
V1ra8 T C 6: 90,203,526 L237P probably benign Het
Vcpip1 G A 1: 9,747,840 T106M probably damaging Het
Vmn1r215 T G 13: 23,075,811 I7S possibly damaging Het
Vmn1r233 T A 17: 20,994,017 M224L probably benign Het
Xpot A T 10: 121,604,549 D592E probably damaging Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
R7606:Atp8b1 UTSW 18 64555115 missense probably damaging 1.00
R7635:Atp8b1 UTSW 18 64573305 missense possibly damaging 0.59
R7639:Atp8b1 UTSW 18 64564543 missense possibly damaging 0.91
R7698:Atp8b1 UTSW 18 64571022 missense probably benign 0.03
R7727:Atp8b1 UTSW 18 64545275 missense probably damaging 1.00
R7779:Atp8b1 UTSW 18 64541382 missense probably damaging 1.00
R7785:Atp8b1 UTSW 18 64556850 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGCTTTGCGATTGCTTAAC -3'
(R):5'- ATCCAGAAGCATCGAAAGCG -3'

Sequencing Primer
(F):5'- ACAGCACAATCCTAGAAGTTTATTG -3'
(R):5'- TCGAAAGCGATTGAAGGCTG -3'
Posted On2016-11-08