Incidental Mutation 'R5652:Uggt1'
ID 441455
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene Name UDP-glucose glycoprotein glucosyltransferase 1
Synonyms C820010P03Rik, 0910001L17Rik, Ugcgl1, A930007H10Rik
MMRRC Submission 043298-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.330) question?
Stock # R5652 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 36179109-36283407 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 36255234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 225 (Y225*)
Ref Sequence ENSEMBL: ENSMUSP00000134640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
AlphaFold Q6P5E4
Predicted Effect probably null
Transcript: ENSMUST00000046875
AA Change: Y225*
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: Y225*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000174266
AA Change: Y225*
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470
AA Change: Y225*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174716
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,856,339 (GRCm39) I334V probably benign Het
Adamts5 C T 16: 85,696,156 (GRCm39) A334T probably damaging Het
Adcy4 G C 14: 56,010,900 (GRCm39) F672L probably benign Het
Adgrl1 A G 8: 84,656,444 (GRCm39) Y254C probably damaging Het
Adnp2 A G 18: 80,174,065 (GRCm39) S115P probably damaging Het
Aox1 A T 1: 58,134,356 (GRCm39) S1110C probably damaging Het
Arhgap44 G T 11: 64,915,064 (GRCm39) N401K probably damaging Het
Atp23 A T 10: 126,735,494 (GRCm39) N63K possibly damaging Het
Atp8b1 G C 18: 64,664,453 (GRCm39) I1238M probably benign Het
Ccdc38 A T 10: 93,391,448 (GRCm39) probably null Het
Celsr2 T C 3: 108,304,051 (GRCm39) D2364G probably null Het
Celsr3 G A 9: 108,715,671 (GRCm39) D2116N probably benign Het
Cenpf A G 1: 189,389,279 (GRCm39) S1518P probably damaging Het
Clcn3 C A 8: 61,372,387 (GRCm39) V758L possibly damaging Het
Cmklr2 A G 1: 63,222,626 (GRCm39) V203A probably benign Het
Ctsf T C 19: 4,908,505 (GRCm39) L288P probably damaging Het
Cwh43 A G 5: 73,575,484 (GRCm39) T334A probably damaging Het
Cyp3a57 A T 5: 145,286,135 (GRCm39) probably null Het
Ddr1 C T 17: 35,997,400 (GRCm39) A531T probably benign Het
Dennd1a A G 2: 37,691,138 (GRCm39) I260T probably benign Het
Dgkh T C 14: 78,865,201 (GRCm39) H47R probably damaging Het
Dync1h1 G A 12: 110,632,422 (GRCm39) V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 (GRCm39) M66K probably benign Het
Fam186a T G 15: 99,843,253 (GRCm39) Y997S possibly damaging Het
Fam8a1 T A 13: 46,827,814 (GRCm39) L334H probably damaging Het
Fat4 C T 3: 39,057,117 (GRCm39) T4271I probably damaging Het
Fdxacb1 T A 9: 50,679,705 (GRCm39) L41Q probably damaging Het
Fgfr2 C T 7: 129,863,593 (GRCm39) V18M probably damaging Het
Gpa33 A C 1: 165,992,714 (GRCm39) probably null Het
Gpr107 A G 2: 31,075,601 (GRCm39) I371V probably benign Het
H1f6 A G 13: 23,880,219 (GRCm39) K124R probably benign Het
Hectd2 T C 19: 36,581,720 (GRCm39) V420A probably damaging Het
Iglc3 A G 16: 18,884,420 (GRCm39) probably benign Het
Igtp A G 11: 58,097,455 (GRCm39) T209A probably benign Het
Itgb7 T A 15: 102,124,638 (GRCm39) N793I possibly damaging Het
Kansl1 G A 11: 104,228,992 (GRCm39) R870C probably damaging Het
Kcnh6 C T 11: 105,899,811 (GRCm39) R27C probably damaging Het
Kif2b T A 11: 91,466,656 (GRCm39) E542D possibly damaging Het
Klhl24 C A 16: 19,938,997 (GRCm39) Y517* probably null Het
Klhl25 A G 7: 75,515,895 (GRCm39) D267G probably benign Het
Krr1 C A 10: 111,813,288 (GRCm39) F195L possibly damaging Het
Lsr C T 7: 30,658,456 (GRCm39) G95D probably damaging Het
Matcap2 A G 9: 22,335,786 (GRCm39) T135A probably benign Het
Med15 A T 16: 17,473,055 (GRCm39) I504N probably damaging Het
Mug1 A G 6: 121,817,140 (GRCm39) R70G probably benign Het
Mypn T A 10: 62,971,580 (GRCm39) Q820L probably damaging Het
Nlrp4f A T 13: 65,330,803 (GRCm39) H863Q probably benign Het
Nudt9 G A 5: 104,207,646 (GRCm39) V213M probably benign Het
Or5ak4 T A 2: 85,161,717 (GRCm39) N175I probably damaging Het
Or5k14 A G 16: 58,692,847 (GRCm39) L222P probably damaging Het
Or7g16 A G 9: 18,726,922 (GRCm39) S223P probably damaging Het
Or8c13 T C 9: 38,092,111 (GRCm39) T3A probably benign Het
Orc2 A G 1: 58,505,231 (GRCm39) F475L probably damaging Het
Oxa1l T A 14: 54,604,289 (GRCm39) L183* probably null Het
Pcdh20 T C 14: 88,704,760 (GRCm39) T847A probably damaging Het
Pcdha6 G A 18: 37,101,889 (GRCm39) probably null Het
Pip5k1a T C 3: 94,974,750 (GRCm39) N376S probably benign Het
Pkd1l1 T C 11: 8,859,889 (GRCm39) E573G probably benign Het
Pkp1 T A 1: 135,810,335 (GRCm39) probably null Het
Pum1 T C 4: 130,491,438 (GRCm39) I643T possibly damaging Het
Rapgef3 A G 15: 97,656,318 (GRCm39) S328P probably benign Het
Raver1 A G 9: 21,001,608 (GRCm39) V75A probably damaging Het
Rbm28 T C 6: 29,135,408 (GRCm39) E511G probably damaging Het
Satb1 T A 17: 52,049,823 (GRCm39) T544S probably damaging Het
Sdcbp2 T C 2: 151,431,135 (GRCm39) V248A probably benign Het
Sema7a A G 9: 57,867,942 (GRCm39) D506G probably damaging Het
Septin8 A G 11: 53,428,044 (GRCm39) E286G probably damaging Het
Sh3pxd2b A G 11: 32,372,812 (GRCm39) I660V probably damaging Het
Stk38l G T 6: 146,674,826 (GRCm39) D364Y possibly damaging Het
Sycp2 T C 2: 178,000,498 (GRCm39) probably null Het
Tbc1d31 T A 15: 57,815,062 (GRCm39) S580T probably damaging Het
Tcerg1l G A 7: 137,881,775 (GRCm39) R305C probably damaging Het
Tek T A 4: 94,743,561 (GRCm39) Y859N probably damaging Het
Tjp1 A T 7: 64,962,191 (GRCm39) probably null Het
Tmem132d A T 5: 127,861,859 (GRCm39) I754N possibly damaging Het
Togaram1 G A 12: 65,063,424 (GRCm39) V1580I probably benign Het
Troap A G 15: 98,980,145 (GRCm39) T442A probably benign Het
Ttn A T 2: 76,712,097 (GRCm39) probably benign Het
Twnk T A 19: 44,995,732 (GRCm39) V55E possibly damaging Het
Vmn2r109 A G 17: 20,760,781 (GRCm39) *859Q probably null Het
Vmn2r17 A T 5: 109,577,430 (GRCm39) I494L probably benign Het
Vmn2r88 T C 14: 51,656,029 (GRCm39) V746A probably damaging Het
Yae1d1 A G 13: 18,166,291 (GRCm39) L57P probably damaging Het
Zfp26 G A 9: 20,349,137 (GRCm39) R476* probably null Het
Zmynd8 T A 2: 165,649,618 (GRCm39) Q816L probably damaging Het
Zswim8 A T 14: 20,763,495 (GRCm39) H414L possibly damaging Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36,218,633 (GRCm39) splice site probably benign
IGL00817:Uggt1 APN 1 36,225,013 (GRCm39) missense probably benign 0.03
IGL01395:Uggt1 APN 1 36,194,158 (GRCm39) missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36,221,555 (GRCm39) missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36,200,775 (GRCm39) missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36,215,875 (GRCm39) missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36,223,565 (GRCm39) missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36,203,600 (GRCm39) makesense probably null
IGL02346:Uggt1 APN 1 36,218,751 (GRCm39) missense probably benign 0.00
IGL02447:Uggt1 APN 1 36,189,223 (GRCm39) missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36,216,696 (GRCm39) missense probably benign 0.03
IGL02930:Uggt1 APN 1 36,196,537 (GRCm39) missense probably benign 0.01
IGL03153:Uggt1 APN 1 36,241,899 (GRCm39) missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36,247,037 (GRCm39) missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36,202,342 (GRCm39) missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36,189,129 (GRCm39) missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36,201,434 (GRCm39) missense probably benign 0.37
R0037:Uggt1 UTSW 1 36,225,013 (GRCm39) missense probably benign 0.03
R0037:Uggt1 UTSW 1 36,225,013 (GRCm39) missense probably benign 0.03
R0167:Uggt1 UTSW 1 36,209,278 (GRCm39) critical splice donor site probably null
R0373:Uggt1 UTSW 1 36,218,751 (GRCm39) missense probably benign 0.00
R0502:Uggt1 UTSW 1 36,199,027 (GRCm39) missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36,235,052 (GRCm39) missense probably benign 0.00
R0610:Uggt1 UTSW 1 36,204,587 (GRCm39) splice site probably benign
R0671:Uggt1 UTSW 1 36,194,209 (GRCm39) missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36,200,805 (GRCm39) missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36,197,224 (GRCm39) missense probably benign 0.01
R0827:Uggt1 UTSW 1 36,195,394 (GRCm39) critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36,214,159 (GRCm39) missense probably benign 0.00
R1112:Uggt1 UTSW 1 36,212,627 (GRCm39) missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36,215,877 (GRCm39) missense probably benign 0.13
R1470:Uggt1 UTSW 1 36,215,877 (GRCm39) missense probably benign 0.13
R1592:Uggt1 UTSW 1 36,241,939 (GRCm39) missense probably benign 0.04
R1730:Uggt1 UTSW 1 36,260,342 (GRCm39) missense probably benign 0.05
R1923:Uggt1 UTSW 1 36,218,694 (GRCm39) missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36,190,862 (GRCm39) missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36,231,495 (GRCm39) missense probably null 1.00
R2829:Uggt1 UTSW 1 36,201,375 (GRCm39) missense probably benign 0.38
R3431:Uggt1 UTSW 1 36,249,140 (GRCm39) nonsense probably null
R3432:Uggt1 UTSW 1 36,249,140 (GRCm39) nonsense probably null
R3725:Uggt1 UTSW 1 36,221,588 (GRCm39) nonsense probably null
R3880:Uggt1 UTSW 1 36,215,885 (GRCm39) intron probably benign
R4052:Uggt1 UTSW 1 36,203,570 (GRCm39) missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36,197,240 (GRCm39) missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36,185,749 (GRCm39) nonsense probably null
R4570:Uggt1 UTSW 1 36,189,154 (GRCm39) missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36,241,936 (GRCm39) nonsense probably null
R4895:Uggt1 UTSW 1 36,195,345 (GRCm39) missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36,241,936 (GRCm39) nonsense probably null
R5372:Uggt1 UTSW 1 36,283,141 (GRCm39) splice site probably benign
R5385:Uggt1 UTSW 1 36,223,493 (GRCm39) missense probably damaging 1.00
R5694:Uggt1 UTSW 1 36,218,737 (GRCm39) missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36,200,852 (GRCm39) splice site probably null
R5893:Uggt1 UTSW 1 36,266,709 (GRCm39) splice site probably null
R6191:Uggt1 UTSW 1 36,201,289 (GRCm39) missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36,202,309 (GRCm39) missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36,273,997 (GRCm39) missense probably benign 0.00
R6399:Uggt1 UTSW 1 36,202,447 (GRCm39) missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36,214,032 (GRCm39) missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36,212,531 (GRCm39) missense probably benign 0.00
R6788:Uggt1 UTSW 1 36,269,769 (GRCm39) missense probably benign 0.00
R7165:Uggt1 UTSW 1 36,194,188 (GRCm39) missense probably benign 0.41
R7255:Uggt1 UTSW 1 36,185,187 (GRCm39) missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36,201,302 (GRCm39) missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36,190,814 (GRCm39) missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36,203,589 (GRCm39) missense probably benign 0.01
R7570:Uggt1 UTSW 1 36,224,919 (GRCm39) missense probably benign 0.09
R7612:Uggt1 UTSW 1 36,202,316 (GRCm39) missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36,185,806 (GRCm39) missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36,247,065 (GRCm39) missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36,202,396 (GRCm39) missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36,195,339 (GRCm39) missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36,247,115 (GRCm39) missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36,250,554 (GRCm39) missense possibly damaging 0.70
R8093:Uggt1 UTSW 1 36,266,566 (GRCm39) missense probably damaging 1.00
R8245:Uggt1 UTSW 1 36,204,645 (GRCm39) missense probably damaging 1.00
R8338:Uggt1 UTSW 1 36,266,602 (GRCm39) missense probably damaging 1.00
R8353:Uggt1 UTSW 1 36,209,377 (GRCm39) critical splice acceptor site probably null
R8442:Uggt1 UTSW 1 36,212,568 (GRCm39) missense probably damaging 0.99
R8519:Uggt1 UTSW 1 36,215,724 (GRCm39) splice site probably null
R8529:Uggt1 UTSW 1 36,223,513 (GRCm39) missense possibly damaging 0.85
R8730:Uggt1 UTSW 1 36,236,624 (GRCm39) critical splice donor site probably null
R8917:Uggt1 UTSW 1 36,185,735 (GRCm39) missense
R8947:Uggt1 UTSW 1 36,197,229 (GRCm39) missense probably benign 0.12
R9240:Uggt1 UTSW 1 36,221,696 (GRCm39) missense possibly damaging 0.50
R9248:Uggt1 UTSW 1 36,249,103 (GRCm39) missense possibly damaging 0.80
R9401:Uggt1 UTSW 1 36,255,212 (GRCm39) critical splice donor site probably null
R9414:Uggt1 UTSW 1 36,223,507 (GRCm39) missense probably benign 0.01
R9416:Uggt1 UTSW 1 36,203,603 (GRCm39) missense
R9441:Uggt1 UTSW 1 36,260,306 (GRCm39) missense probably benign 0.02
R9489:Uggt1 UTSW 1 36,273,886 (GRCm39) critical splice donor site probably null
R9563:Uggt1 UTSW 1 36,204,627 (GRCm39) missense possibly damaging 0.60
R9605:Uggt1 UTSW 1 36,273,886 (GRCm39) critical splice donor site probably null
X0022:Uggt1 UTSW 1 36,204,636 (GRCm39) missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36,213,272 (GRCm39) missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36,200,776 (GRCm39) missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36,194,154 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTAGCACCCAGACTGC -3'
(R):5'- TGTTGTCAACCAGTGTCCTG -3'

Sequencing Primer
(F):5'- GGGTAACACAGTAAGACCCTGTTTC -3'
(R):5'- CCCTCATCAAATCCTGAGAG -3'
Posted On 2016-11-08