Incidental Mutation 'R5652:Aox1'
ID441456
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Namealdehyde oxidase 1
SynonymsAox-1, Aox2, retinal oxidase, Aox-2
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58029931-58106413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58095197 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1110 (S1110C)
Ref Sequence ENSEMBL: ENSMUSP00000001027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001027]
Predicted Effect probably damaging
Transcript: ENSMUST00000001027
AA Change: S1110C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: S1110C

DomainStartEndE-ValueType
Pfam:Fer2 8 78 8.5e-11 PFAM
Pfam:Fer2_2 87 161 2.4e-32 PFAM
low complexity region 197 209 N/A INTRINSIC
Pfam:FAD_binding_5 238 418 1.2e-46 PFAM
CO_deh_flav_C 425 529 8.06e-24 SMART
Ald_Xan_dh_C 593 696 6.99e-42 SMART
Pfam:Ald_Xan_dh_C2 707 1240 2.1e-176 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58059044 missense probably damaging 1.00
IGL01077:Aox1 APN 1 58057410 splice site probably benign
IGL01335:Aox1 APN 1 58082153 nonsense probably null
IGL01410:Aox1 APN 1 58106025 splice site probably null
IGL01684:Aox1 APN 1 58077581 splice site probably null
IGL01727:Aox1 APN 1 58073228 nonsense probably null
IGL01805:Aox1 APN 1 58081513 missense possibly damaging 0.94
IGL01996:Aox1 APN 1 58082066 missense probably benign 0.11
IGL02060:Aox1 APN 1 58097955 missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58065340 missense probably benign 0.00
IGL02839:Aox1 APN 1 58068784 missense probably benign 0.05
IGL02975:Aox1 APN 1 58068391 missense probably damaging 1.00
IGL03062:Aox1 APN 1 58078465 missense probably benign 0.01
IGL03286:Aox1 APN 1 58049384 missense probably benign 0.19
IGL03335:Aox1 APN 1 58076160 missense probably damaging 0.98
IGL03395:Aox1 APN 1 58068725 splice site probably benign
R0048:Aox1 UTSW 1 58073212 missense probably damaging 0.98
R0144:Aox1 UTSW 1 58070074 missense probably benign 0.00
R0207:Aox1 UTSW 1 58105014 missense possibly damaging 0.82
R0357:Aox1 UTSW 1 58092516 missense probably damaging 1.00
R0383:Aox1 UTSW 1 58061241 missense probably benign 0.00
R0399:Aox1 UTSW 1 58068849 splice site probably null
R0465:Aox1 UTSW 1 58062207 missense probably damaging 1.00
R0480:Aox1 UTSW 1 58043651 splice site probably benign
R1005:Aox1 UTSW 1 58065352 missense probably benign 0.00
R1507:Aox1 UTSW 1 58104451 missense probably benign 0.01
R1597:Aox1 UTSW 1 58047167 missense probably damaging 1.00
R1693:Aox1 UTSW 1 58085542 missense probably damaging 1.00
R1709:Aox1 UTSW 1 58077474 missense probably benign
R1869:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1870:Aox1 UTSW 1 58076103 missense probably damaging 1.00
R1898:Aox1 UTSW 1 58078442 missense probably damaging 1.00
R1908:Aox1 UTSW 1 58102624 missense probably damaging 1.00
R2002:Aox1 UTSW 1 58047141 missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58059192 splice site probably null
R2065:Aox1 UTSW 1 58059192 splice site probably null
R2265:Aox1 UTSW 1 58081520 missense probably damaging 0.99
R3713:Aox1 UTSW 1 58056215 missense probably benign 0.01
R3778:Aox1 UTSW 1 58053703 missense possibly damaging 0.89
R4198:Aox1 UTSW 1 58085607 missense probably benign
R4296:Aox1 UTSW 1 58057400 splice site probably null
R4562:Aox1 UTSW 1 58059056 missense probably damaging 0.99
R4858:Aox1 UTSW 1 58104481 missense probably benign
R4862:Aox1 UTSW 1 58095157 missense probably damaging 0.98
R5048:Aox1 UTSW 1 58059482 splice site probably benign
R5127:Aox1 UTSW 1 58030026 missense probably benign 0.00
R5139:Aox1 UTSW 1 58061297 missense probably benign 0.03
R5157:Aox1 UTSW 1 58070063 missense probably damaging 1.00
R5168:Aox1 UTSW 1 58049402 missense probably damaging 1.00
R5186:Aox1 UTSW 1 58068370 missense probably damaging 1.00
R5235:Aox1 UTSW 1 58057555 missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58092558 missense probably damaging 0.99
R5466:Aox1 UTSW 1 58041460 missense probably damaging 1.00
R5540:Aox1 UTSW 1 58104410 missense probably benign 0.03
R5615:Aox1 UTSW 1 58096966 missense probably benign
R5920:Aox1 UTSW 1 58049472 missense probably damaging 1.00
R6008:Aox1 UTSW 1 58077513 missense probably damaging 1.00
R6073:Aox1 UTSW 1 58104509 critical splice donor site probably null
R6215:Aox1 UTSW 1 58085461 missense probably benign
R6403:Aox1 UTSW 1 58068435 missense probably damaging 1.00
R6440:Aox1 UTSW 1 58094472 missense probably damaging 1.00
R6601:Aox1 UTSW 1 58063506 missense probably damaging 1.00
R6608:Aox1 UTSW 1 58057546 missense probably benign 0.40
R6752:Aox1 UTSW 1 58047239 missense probably benign 0.00
R6989:Aox1 UTSW 1 58085452 missense probably damaging 1.00
R7042:Aox1 UTSW 1 58102600 missense probably damaging 0.99
R7442:Aox1 UTSW 1 58082013 missense probably damaging 1.00
R7506:Aox1 UTSW 1 58049403 missense probably damaging 1.00
R7563:Aox1 UTSW 1 58047145 missense probably benign 0.32
R7589:Aox1 UTSW 1 58041484 missense probably damaging 1.00
R7735:Aox1 UTSW 1 58068292 missense probably benign 0.01
R7814:Aox1 UTSW 1 58085467 missense probably benign
R7876:Aox1 UTSW 1 58062171 nonsense probably null
R7905:Aox1 UTSW 1 58104398 missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58106068 missense possibly damaging 0.68
R8116:Aox1 UTSW 1 58076124 missense probably damaging 1.00
R8179:Aox1 UTSW 1 58097958 missense probably damaging 1.00
R8264:Aox1 UTSW 1 58053714 missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58076091 missense probably damaging 1.00
R8415:Aox1 UTSW 1 58041479 missense probably damaging 1.00
Z1088:Aox1 UTSW 1 58081542 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATGCAGCCTTTCATGTC -3'
(R):5'- CATGCAATGACAGTGTCTTTGAG -3'

Sequencing Primer
(F):5'- ATGTCATCCTCTACTGCCTTGATAC -3'
(R):5'- GAGTTGTCCTTTCCACAAACATAG -3'
Posted On2016-11-08