Mutagenetix > Incidental Mutations

Incidental Mutation 'R5652:Orc2'

441457

Institutional Source

Beutler Lab

Gene Symbol

Orc2

Ensembl Gene

ENSMUSG00000026037

Gene Name

origin recognition complex, subunit 2

Synonyms

Orc2l

MMRRC Submission

043298-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58462771-58505109 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58466072 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 475 (F475L)

Ref Sequence

ENSEMBL: ENSMUSP00000109964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000087521] [ENSMUST00000114325] [ENSMUST00000114337] [ENSMUST00000171597]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027198
AA Change: F523L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: F523L

Domain	Start	End	E-Value	Type
low complexity region	176	201	N/A	INTRINSIC
Pfam:ORC2	254	563	2.5e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000087521

SMART Domains

Protein: ENSMUSP00000084799
Gene: ENSMUSG00000026036

Domain	Start	End	E-Value	Type
Pfam:NIF3	31	363	1.9e-82	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114325
AA Change: F475L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037
AA Change: F475L

Domain	Start	End	E-Value	Type
low complexity region	128	153	N/A	INTRINSIC
Pfam:ORC2	206	517	1.2e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114337

SMART Domains

Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036

Domain	Start	End	E-Value	Type
Pfam:NIF3	31	324	4e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171597

SMART Domains

Protein: ENSMUSP00000127501
Gene: ENSMUSG00000026036

Domain	Start	End	E-Value	Type
Pfam:NIF3	31	363	2.5e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188295

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	G	9: 22,424,490	T135A	probably benign	Het
Abcc4	T	C	14: 118,618,927	I334V	probably benign	Het
Adamts5	C	T	16: 85,899,268	A334T	probably damaging	Het
Adcy4	G	C	14: 55,773,443	F672L	probably benign	Het
Adgrl1	A	G	8: 83,929,815	Y254C	probably damaging	Het
Adnp2	A	G	18: 80,130,850	S115P	probably damaging	Het
Aox1	A	T	1: 58,095,197	S1110C	probably damaging	Het
Arhgap44	G	T	11: 65,024,238	N401K	probably damaging	Het
Atp23	A	T	10: 126,899,625	N63K	possibly damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr2	T	C	3: 108,396,735	D2364G	probably null	Het
Celsr3	G	A	9: 108,838,472	D2116N	probably benign	Het
Cenpf	A	G	1: 189,657,082	S1518P	probably damaging	Het
Clcn3	C	A	8: 60,919,353	V758L	possibly damaging	Het
Ctsf	T	C	19: 4,858,477	L288P	probably damaging	Het
Cwh43	A	G	5: 73,418,141	T334A	probably damaging	Het
Cyp3a57	A	T	5: 145,349,325		probably null	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dennd1a	A	G	2: 37,801,126	I260T	probably benign	Het
Dgkh	T	C	14: 78,627,761	H47R	probably damaging	Het
Dync1h1	G	A	12: 110,665,988	V4514I	possibly damaging	Het
Dync2h1	A	T	9: 7,116,638	M66K	probably benign	Het
Fam186a	T	G	15: 99,945,372	Y997S	possibly damaging	Het
Fam8a1	T	A	13: 46,674,338	L334H	probably damaging	Het
Fat4	C	T	3: 39,002,968	T4271I	probably damaging	Het
Fdxacb1	T	A	9: 50,768,405	L41Q	probably damaging	Het
Fgfr2	C	T	7: 130,261,863	V18M	probably damaging	Het
Gpa33	A	C	1: 166,165,145		probably null	Het
Gpr1	A	G	1: 63,183,467	V203A	probably benign	Het
Gpr107	A	G	2: 31,185,589	I371V	probably benign	Het
Hectd2	T	C	19: 36,604,320	V420A	probably damaging	Het
Hist1h1t	A	G	13: 23,696,236	K124R	probably benign	Het
Iglc3	A	G	16: 19,065,670		probably benign	Het
Igtp	A	G	11: 58,206,629	T209A	probably benign	Het
Itgb7	T	A	15: 102,216,203	N793I	possibly damaging	Het
Kansl1	G	A	11: 104,338,166	R870C	probably damaging	Het
Kcnh6	C	T	11: 106,008,985	R27C	probably damaging	Het
Kif2b	T	A	11: 91,575,830	E542D	possibly damaging	Het
Klhl24	C	A	16: 20,120,247	Y517*	probably null	Het
Klhl25	A	G	7: 75,866,147	D267G	probably benign	Het
Krr1	C	A	10: 111,977,383	F195L	possibly damaging	Het
Lsr	C	T	7: 30,959,031	G95D	probably damaging	Het
Med15	A	T	16: 17,655,191	I504N	probably damaging	Het
Mug1	A	G	6: 121,840,181	R70G	probably benign	Het
Mypn	T	A	10: 63,135,801	Q820L	probably damaging	Het
Nlrp4f	A	T	13: 65,182,989	H863Q	probably benign	Het
Nudt9	G	A	5: 104,059,780	V213M	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr828	A	G	9: 18,815,626	S223P	probably damaging	Het
Olfr891	T	C	9: 38,180,815	T3A	probably benign	Het
Olfr987	T	A	2: 85,331,373	N175I	probably damaging	Het
Oxa1l	T	A	14: 54,366,832	L183*	probably null	Het
Pcdh20	T	C	14: 88,467,324	T847A	probably damaging	Het
Pcdha6	G	A	18: 36,968,836		probably null	Het
Pip5k1a	T	C	3: 95,067,439	N376S	probably benign	Het
Pkd1l1	T	C	11: 8,909,889	E573G	probably benign	Het
Pkp1	T	A	1: 135,882,597		probably null	Het
Pum1	T	C	4: 130,764,127	I643T	possibly damaging	Het
Rapgef3	A	G	15: 97,758,437	S328P	probably benign	Het
Raver1	A	G	9: 21,090,312	V75A	probably damaging	Het
Rbm28	T	C	6: 29,135,409	E511G	probably damaging	Het
Satb1	T	A	17: 51,742,795	T544S	probably damaging	Het
Sdcbp2	T	C	2: 151,589,215	V248A	probably benign	Het
Sema7a	A	G	9: 57,960,659	D506G	probably damaging	Het
Sept8	A	G	11: 53,537,217	E286G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,422,812	I660V	probably damaging	Het
Stk38l	G	T	6: 146,773,328	D364Y	possibly damaging	Het
Sycp2	T	C	2: 178,358,705		probably null	Het
Tbc1d31	T	A	15: 57,951,666	S580T	probably damaging	Het
Tcerg1l	G	A	7: 138,280,046	R305C	probably damaging	Het
Tek	T	A	4: 94,855,324	Y859N	probably damaging	Het
Tjp1	A	T	7: 65,312,443		probably null	Het
Tmem132d	A	T	5: 127,784,795	I754N	possibly damaging	Het
Togaram1	G	A	12: 65,016,650	V1580I	probably benign	Het
Troap	A	G	15: 99,082,264	T442A	probably benign	Het
Ttn	A	T	2: 76,881,753		probably benign	Het
Twnk	T	A	19: 45,007,293	V55E	possibly damaging	Het
Uggt1	A	T	1: 36,216,153	Y225*	probably null	Het
Vmn2r109	A	G	17: 20,540,519	*859Q	probably null	Het
Vmn2r17	A	T	5: 109,429,564	I494L	probably benign	Het
Vmn2r88	T	C	14: 51,418,572	V746A	probably damaging	Het
Yae1d1	A	G	13: 17,991,706	L57P	probably damaging	Het
Zfp26	G	A	9: 20,437,841	R476*	probably null	Het
Zmynd8	T	A	2: 165,807,698	Q816L	probably damaging	Het
Zswim8	A	T	14: 20,713,427	H414L	possibly damaging	Het

Other mutations in Orc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Orc2	APN	1	58493716	missense	possibly damaging	0.81
IGL00549:Orc2	APN	1	58481042	missense	probably benign	0.00
IGL01343:Orc2	APN	1	58492855	critical splice donor site	probably null
IGL01357:Orc2	APN	1	58497392	missense	probably benign	0.26
IGL01357:Orc2	APN	1	58497393	missense	probably benign	0.00
IGL02167:Orc2	APN	1	58483639	unclassified	probably benign
IGL02343:Orc2	APN	1	58469666	critical splice donor site	probably null
IGL02548:Orc2	APN	1	58466122	unclassified	probably benign
R0557:Orc2	UTSW	1	58469687	missense	probably damaging	1.00
R1470:Orc2	UTSW	1	58481158	unclassified	probably benign
R1886:Orc2	UTSW	1	58471088	critical splice acceptor site	probably null
R2065:Orc2	UTSW	1	58469695	missense	probably damaging	1.00
R3848:Orc2	UTSW	1	58480992	missense	probably benign	0.08
R4389:Orc2	UTSW	1	58474861	missense	probably benign	0.21
R4393:Orc2	UTSW	1	58467650	critical splice donor site	probably null
R4613:Orc2	UTSW	1	58500309	nonsense	probably null
R5183:Orc2	UTSW	1	58474818	missense	possibly damaging	0.83
R5793:Orc2	UTSW	1	58497388	start codon destroyed	probably null	0.27
R5997:Orc2	UTSW	1	58472388	missense	probably damaging	1.00
R6007:Orc2	UTSW	1	58467692	missense	probably benign	0.03
R6330:Orc2	UTSW	1	58500334	missense	probably benign
R6656:Orc2	UTSW	1	58493659	critical splice donor site	probably null
R6923:Orc2	UTSW	1	58500375	missense	probably benign	0.01
R6934:Orc2	UTSW	1	58500364	missense	probably benign	0.28
R7354:Orc2	UTSW	1	58469747	missense	possibly damaging	0.96
R7718:Orc2	UTSW	1	58480317	missense	possibly damaging	0.65
R7950:Orc2	UTSW	1	58467668	missense	possibly damaging	0.64
R8820:Orc2	UTSW	1	58476480	missense	probably benign	0.30
R8858:Orc2	UTSW	1	58493698	missense	probably benign	0.28
Z1088:Orc2	UTSW	1	58476516	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGATGCATTCCGTCTATTGC -3'
(R):5'- TAGGGGACTTTCGGGATAGC -3'

Sequencing Primer
(F):5'- TGGCCTCTCAGAAGCATCC -3'
(R):5'- GACTTTCGGGATAGCATTTGAAATG -3'

Posted On

2016-11-08