Incidental Mutation 'R5652:Sycp2'
ID441469
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 178358705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect probably null
Transcript: ENSMUST00000081134
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
R7960:Sycp2 UTSW 2 178404660 missense probably null 0.90
R8022:Sycp2 UTSW 2 178355062 missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178374585 missense probably benign 0.05
R8159:Sycp2 UTSW 2 178354977 missense probably damaging 0.97
R8233:Sycp2 UTSW 2 178356634 missense probably damaging 1.00
R8436:Sycp2 UTSW 2 178362968 missense probably benign 0.44
R8437:Sycp2 UTSW 2 178364858 missense probably damaging 1.00
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Z1176:Sycp2 UTSW 2 178364881 missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178380875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTTAAGTGTGTGCGTATGC -3'
(R):5'- GCTTGAAGTCACATGAAGCAGG -3'

Sequencing Primer
(F):5'- GTGTGCAGGTACACACAT -3'
(R):5'- TCACATGAAGCAGGGAAGC -3'
Posted On2016-11-08