Incidental Mutation 'R5652:Fgfr2'
ID441484
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130261863 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 18 (V18M)
Ref Sequence ENSEMBL: ENSMUSP00000113994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably benign
Transcript: ENSMUST00000117073
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117089
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117357
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117691
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117754
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117858
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117872
AA Change: V18M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849
AA Change: V18M

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118296
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119260
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120141
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120187
AA Change: V18M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849
AA Change: V18M

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120715
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121064
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121080
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122054
AA Change: V18M

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849
AA Change: V18M

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122448
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129103
Predicted Effect possibly damaging
Transcript: ENSMUST00000153166
AA Change: V18M

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849
AA Change: V18M

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208844
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 splice site probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0631:Fgfr2 UTSW 7 130227239 intron probably benign
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1670:Fgfr2 UTSW 7 130180457 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 splice site probably null
R3706:Fgfr2 UTSW 7 130198431 missense probably benign 0.31
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4438:Fgfr2 UTSW 7 130172930 nonsense probably null
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5375:Fgfr2 UTSW 7 130241215 missense possibly damaging 0.65
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
R7246:Fgfr2 UTSW 7 130242406
R7937:Fgfr2 UTSW 7 130219093 missense probably damaging 1.00
R7976:Fgfr2 UTSW 7 130185344 missense probably damaging 0.99
R8007:Fgfr2 UTSW 7 130163989 nonsense probably null
R8189:Fgfr2 UTSW 7 130172899 missense probably damaging 1.00
R8430:Fgfr2 UTSW 7 130163978 missense probably damaging 1.00
R8486:Fgfr2 UTSW 7 130164015 missense possibly damaging 0.93
R8489:Fgfr2 UTSW 7 130167804 missense probably benign 0.01
R8776:Fgfr2 UTSW 7 130196272 missense possibly damaging 0.64
R8776-TAIL:Fgfr2 UTSW 7 130196272 missense possibly damaging 0.64
RF016:Fgfr2 UTSW 7 130177680 missense probably benign 0.03
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Z1177:Fgfr2 UTSW 7 130198457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGGCAGCCGGCTGAAAC -3'
(R):5'- TTAAGCAAGTTGGCACTGGGG -3'

Sequencing Primer
(F):5'- GCTGAAACAGGCCTCCC -3'
(R):5'- AACTGAATCTGGCTGAATCTCTC -3'
Posted On2016-11-08