Mutagenetix > Incidental Mutation

Incidental Mutation 'R5652:Clcn3'

441486

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

043298-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.427) question?

Stock #

R5652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 60919353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 758 (V758L)

Ref Sequence

ENSEMBL: ENSMUSP00000058648 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004430
AA Change: V785L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: V785L

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056508
AA Change: V758L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: V758L

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093490
AA Change: V727L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: V727L

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301
AA Change: V785L

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: V785L

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110302
AA Change: V758L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: V758L

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145741

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	G	9: 22,424,490	T135A	probably benign	Het
Abcc4	T	C	14: 118,618,927	I334V	probably benign	Het
Adamts5	C	T	16: 85,899,268	A334T	probably damaging	Het
Adcy4	G	C	14: 55,773,443	F672L	probably benign	Het
Adgrl1	A	G	8: 83,929,815	Y254C	probably damaging	Het
Adnp2	A	G	18: 80,130,850	S115P	probably damaging	Het
Aox1	A	T	1: 58,095,197	S1110C	probably damaging	Het
Arhgap44	G	T	11: 65,024,238	N401K	probably damaging	Het
Atp23	A	T	10: 126,899,625	N63K	possibly damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr2	T	C	3: 108,396,735	D2364G	probably null	Het
Celsr3	G	A	9: 108,838,472	D2116N	probably benign	Het
Cenpf	A	G	1: 189,657,082	S1518P	probably damaging	Het
Ctsf	T	C	19: 4,858,477	L288P	probably damaging	Het
Cwh43	A	G	5: 73,418,141	T334A	probably damaging	Het
Cyp3a57	A	T	5: 145,349,325		probably null	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dennd1a	A	G	2: 37,801,126	I260T	probably benign	Het
Dgkh	T	C	14: 78,627,761	H47R	probably damaging	Het
Dync1h1	G	A	12: 110,665,988	V4514I	possibly damaging	Het
Dync2h1	A	T	9: 7,116,638	M66K	probably benign	Het
Fam186a	T	G	15: 99,945,372	Y997S	possibly damaging	Het
Fam8a1	T	A	13: 46,674,338	L334H	probably damaging	Het
Fat4	C	T	3: 39,002,968	T4271I	probably damaging	Het
Fdxacb1	T	A	9: 50,768,405	L41Q	probably damaging	Het
Fgfr2	C	T	7: 130,261,863	V18M	probably damaging	Het
Gpa33	A	C	1: 166,165,145		probably null	Het
Gpr1	A	G	1: 63,183,467	V203A	probably benign	Het
Gpr107	A	G	2: 31,185,589	I371V	probably benign	Het
Hectd2	T	C	19: 36,604,320	V420A	probably damaging	Het
Hist1h1t	A	G	13: 23,696,236	K124R	probably benign	Het
Iglc3	A	G	16: 19,065,670		probably benign	Het
Igtp	A	G	11: 58,206,629	T209A	probably benign	Het
Itgb7	T	A	15: 102,216,203	N793I	possibly damaging	Het
Kansl1	G	A	11: 104,338,166	R870C	probably damaging	Het
Kcnh6	C	T	11: 106,008,985	R27C	probably damaging	Het
Kif2b	T	A	11: 91,575,830	E542D	possibly damaging	Het
Klhl24	C	A	16: 20,120,247	Y517*	probably null	Het
Klhl25	A	G	7: 75,866,147	D267G	probably benign	Het
Krr1	C	A	10: 111,977,383	F195L	possibly damaging	Het
Lsr	C	T	7: 30,959,031	G95D	probably damaging	Het
Med15	A	T	16: 17,655,191	I504N	probably damaging	Het
Mug1	A	G	6: 121,840,181	R70G	probably benign	Het
Mypn	T	A	10: 63,135,801	Q820L	probably damaging	Het
Nlrp4f	A	T	13: 65,182,989	H863Q	probably benign	Het
Nudt9	G	A	5: 104,059,780	V213M	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr828	A	G	9: 18,815,626	S223P	probably damaging	Het
Olfr891	T	C	9: 38,180,815	T3A	probably benign	Het
Olfr987	T	A	2: 85,331,373	N175I	probably damaging	Het
Orc2	A	G	1: 58,466,072	F475L	probably damaging	Het
Oxa1l	T	A	14: 54,366,832	L183*	probably null	Het
Pcdh20	T	C	14: 88,467,324	T847A	probably damaging	Het
Pcdha6	G	A	18: 36,968,836		probably null	Het
Pip5k1a	T	C	3: 95,067,439	N376S	probably benign	Het
Pkd1l1	T	C	11: 8,909,889	E573G	probably benign	Het
Pkp1	T	A	1: 135,882,597		probably null	Het
Pum1	T	C	4: 130,764,127	I643T	possibly damaging	Het
Rapgef3	A	G	15: 97,758,437	S328P	probably benign	Het
Raver1	A	G	9: 21,090,312	V75A	probably damaging	Het
Rbm28	T	C	6: 29,135,409	E511G	probably damaging	Het
Satb1	T	A	17: 51,742,795	T544S	probably damaging	Het
Sdcbp2	T	C	2: 151,589,215	V248A	probably benign	Het
Sema7a	A	G	9: 57,960,659	D506G	probably damaging	Het
Sept8	A	G	11: 53,537,217	E286G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,422,812	I660V	probably damaging	Het
Stk38l	G	T	6: 146,773,328	D364Y	possibly damaging	Het
Sycp2	T	C	2: 178,358,705		probably null	Het
Tbc1d31	T	A	15: 57,951,666	S580T	probably damaging	Het
Tcerg1l	G	A	7: 138,280,046	R305C	probably damaging	Het
Tek	T	A	4: 94,855,324	Y859N	probably damaging	Het
Tjp1	A	T	7: 65,312,443		probably null	Het
Tmem132d	A	T	5: 127,784,795	I754N	possibly damaging	Het
Togaram1	G	A	12: 65,016,650	V1580I	probably benign	Het
Troap	A	G	15: 99,082,264	T442A	probably benign	Het
Ttn	A	T	2: 76,881,753		probably benign	Het
Twnk	T	A	19: 45,007,293	V55E	possibly damaging	Het
Uggt1	A	T	1: 36,216,153	Y225*	probably null	Het
Vmn2r109	A	G	17: 20,540,519	*859Q	probably null	Het
Vmn2r17	A	T	5: 109,429,564	I494L	probably benign	Het
Vmn2r88	T	C	14: 51,418,572	V746A	probably damaging	Het
Yae1d1	A	G	13: 17,991,706	L57P	probably damaging	Het
Zfp26	G	A	9: 20,437,841	R476*	probably null	Het
Zmynd8	T	A	2: 165,807,698	Q816L	probably damaging	Het
Zswim8	A	T	14: 20,713,427	H414L	possibly damaging	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R0840:Clcn3	UTSW	8	60929154	missense	probably benign	0.22
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4676:Clcn3	UTSW	8	60930651	intron	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R7887:Clcn3	UTSW	8	60941399	missense	probably benign	0.16
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign
R8825:Clcn3	UTSW	8	60929488	missense	probably damaging	0.99
R9132:Clcn3	UTSW	8	60929102	missense	probably damaging	0.99
R9313:Clcn3	UTSW	8	60937469	missense	probably damaging	0.99
R9473:Clcn3	UTSW	8	60954617	missense	probably benign	0.01
R9475:Clcn3	UTSW	8	60934517	missense	probably damaging	0.96
R9598:Clcn3	UTSW	8	60913027	missense	unknown
R9697:Clcn3	UTSW	8	60919484	missense	probably damaging	1.00
R9718:Clcn3	UTSW	8	60937400	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACTCTCAGGGAAGTGTGAAGC -3'
(R):5'- GAAAATGGATCCTTGTCTCTATCTC -3'

Sequencing Primer
(F):5'- GAAGTGTGAAGCTTGACTGATCCTAC -3'
(R):5'- CTATCTCTTTTTCAGAAAGTGCCAG -3'

Posted On

2016-11-08