Incidental Mutation 'R5652:Clcn3'
ID441486
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Namechloride channel, voltage-sensitive 3
SynonymsClc3
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60910389-60983300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60919353 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 758 (V758L)
Ref Sequence ENSEMBL: ENSMUSP00000058648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
Predicted Effect probably benign
Transcript: ENSMUST00000004430
AA Change: V785L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: V785L

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000056508
AA Change: V758L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: V758L

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
AA Change: V727L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: V727L

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
AA Change: V785L

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: V785L

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110302
AA Change: V758L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: V758L

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145741
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 60922792 missense probably damaging 0.99
IGL01088:Clcn3 APN 8 60937347 missense probably damaging 1.00
IGL01449:Clcn3 APN 8 60934598 missense probably damaging 0.97
IGL01792:Clcn3 APN 8 60929322 missense probably damaging 1.00
IGL01845:Clcn3 APN 8 60913095 missense probably benign 0.08
IGL01984:Clcn3 APN 8 60929580 missense probably damaging 1.00
IGL02041:Clcn3 APN 8 60923153 missense probably damaging 0.99
IGL02199:Clcn3 APN 8 60933092 nonsense probably null
IGL02199:Clcn3 APN 8 60927274 missense possibly damaging 0.82
IGL02456:Clcn3 APN 8 60941357 missense probably damaging 1.00
IGL03353:Clcn3 APN 8 60922988 missense probably benign 0.37
Precipice UTSW 8 60941399 missense probably benign 0.16
R0003:Clcn3 UTSW 8 60927296 nonsense probably null
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0349:Clcn3 UTSW 8 60941348 missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 60934537 missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 60929203 missense probably benign 0.25
R0840:Clcn3 UTSW 8 60929154 missense probably benign 0.22
R1167:Clcn3 UTSW 8 60922788 critical splice donor site probably null
R2035:Clcn3 UTSW 8 60934598 missense probably damaging 0.97
R2193:Clcn3 UTSW 8 60929187 missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 60913123 missense probably benign 0.02
R3736:Clcn3 UTSW 8 60983652 unclassified probably benign
R4676:Clcn3 UTSW 8 60930651 intron probably benign
R4807:Clcn3 UTSW 8 60934530 missense probably damaging 1.00
R5112:Clcn3 UTSW 8 60954552 missense probably benign 0.07
R5200:Clcn3 UTSW 8 60923005 missense probably damaging 0.99
R5712:Clcn3 UTSW 8 60937298 critical splice donor site probably null
R5731:Clcn3 UTSW 8 60922889 missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6134:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6370:Clcn3 UTSW 8 60923024 missense probably damaging 1.00
R6371:Clcn3 UTSW 8 60937335 missense probably benign 0.06
R6394:Clcn3 UTSW 8 60941291 missense probably damaging 0.99
R6466:Clcn3 UTSW 8 60929561 missense probably damaging 1.00
R6588:Clcn3 UTSW 8 60914827 missense probably benign 0.03
R6750:Clcn3 UTSW 8 60914775 missense possibly damaging 0.93
R7522:Clcn3 UTSW 8 60941412 missense probably benign
R7556:Clcn3 UTSW 8 60929487 missense probably damaging 0.99
R7557:Clcn3 UTSW 8 60937368 missense probably damaging 0.99
R7685:Clcn3 UTSW 8 60933085 missense possibly damaging 0.54
R7887:Clcn3 UTSW 8 60941399 missense probably benign 0.16
R8219:Clcn3 UTSW 8 60922966 missense probably damaging 0.98
R8478:Clcn3 UTSW 8 60919488 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTCAGGGAAGTGTGAAGC -3'
(R):5'- GAAAATGGATCCTTGTCTCTATCTC -3'

Sequencing Primer
(F):5'- GAAGTGTGAAGCTTGACTGATCCTAC -3'
(R):5'- CTATCTCTTTTTCAGAAAGTGCCAG -3'
Posted On2016-11-08