Incidental Mutation 'R5652:Adgrl1'
ID441487
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Nameadhesion G protein-coupled receptor L1
Synonymslectomedin-2, Lec2, Lphn1, 2900070I05Rik
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83900105-83941954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83929815 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 254 (Y254C)
Ref Sequence ENSEMBL: ENSMUSP00000115295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect probably damaging
Transcript: ENSMUST00000045393
AA Change: Y254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: Y254C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098595
SMART Domains Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124355
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131717
AA Change: Y78C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033
AA Change: Y78C

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132500
AA Change: Y249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: Y249C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139575
Predicted Effect probably damaging
Transcript: ENSMUST00000141158
AA Change: Y249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: Y249C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150674
Predicted Effect probably damaging
Transcript: ENSMUST00000152978
AA Change: Y254C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: Y254C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200106
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 83937703 missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 83929857 missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 83932948 missense probably benign 0.09
IGL02422:Adgrl1 APN 8 83937486 missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 83938514 missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 83931995 missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 83929683 splice site probably null
Swiss_rolls UTSW 8 83918922 missense probably damaging 0.99
R0375:Adgrl1 UTSW 8 83934901 missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 83934650 splice site probably benign
R0681:Adgrl1 UTSW 8 83934650 splice site probably benign
R0964:Adgrl1 UTSW 8 83934412 splice site probably benign
R1182:Adgrl1 UTSW 8 83929822 missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 83937763 missense probably benign 0.23
R1475:Adgrl1 UTSW 8 83938350 missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 83932373 missense probably benign 0.16
R1778:Adgrl1 UTSW 8 83930037 missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 83930117 nonsense probably null
R2403:Adgrl1 UTSW 8 83931241 missense probably benign 0.01
R2935:Adgrl1 UTSW 8 83934560 missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 83923004 missense possibly damaging 0.59
R4191:Adgrl1 UTSW 8 83938940 missense probably benign 0.29
R4393:Adgrl1 UTSW 8 83938593 missense probably benign 0.01
R4406:Adgrl1 UTSW 8 83930042 missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 83934860 missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R4799:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R5214:Adgrl1 UTSW 8 83915573 splice site probably null
R5242:Adgrl1 UTSW 8 83931082 missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 83929742 missense probably damaging 1.00
R5522:Adgrl1 UTSW 8 83923075 missense possibly damaging 0.93
R5607:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 83938601 missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 83932610 missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6129:Adgrl1 UTSW 8 83918987 missense probably damaging 1.00
R6221:Adgrl1 UTSW 8 83937687 nonsense probably null
R7142:Adgrl1 UTSW 8 83937200 missense probably benign 0.38
R7181:Adgrl1 UTSW 8 83926249 splice site probably null
R7238:Adgrl1 UTSW 8 83939064 missense probably damaging 0.99
R7547:Adgrl1 UTSW 8 83938884 missense probably benign 0.00
R7709:Adgrl1 UTSW 8 83938988 missense probably benign 0.03
R7741:Adgrl1 UTSW 8 83929714 missense probably damaging 1.00
R7852:Adgrl1 UTSW 8 83935558 missense probably damaging 1.00
R7866:Adgrl1 UTSW 8 83937935 critical splice donor site probably null
R8146:Adgrl1 UTSW 8 83930989 missense possibly damaging 0.64
R8314:Adgrl1 UTSW 8 83938389 missense probably damaging 1.00
RF007:Adgrl1 UTSW 8 83934772 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGACTGAATATGCCTCATGGGAG -3'
(R):5'- ACCATGAAGGCATTGGAGGC -3'

Sequencing Primer
(F):5'- CTCATGGGAGGACTATGTAGCC -3'
(R):5'- CGAGCGCTTGTCATAGCCTG -3'
Posted On2016-11-08