Incidental Mutation 'R5652:Raver1'
ID441490
Institutional Source Beutler Lab
Gene Symbol Raver1
Ensembl Gene ENSMUSG00000010205
Gene Nameribonucleoprotein, PTB-binding 1
Synonyms
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R5652 (G1)
Quality Score90
Status Not validated
Chromosome9
Chromosomal Location21074158-21092008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21090312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 75 (V75A)
Ref Sequence ENSEMBL: ENSMUSP00000151195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115487] [ENSMUST00000217359]
Predicted Effect probably damaging
Transcript: ENSMUST00000115487
AA Change: V75A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111150
Gene: ENSMUSG00000010205
AA Change: V75A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
RRM 60 126 1.53e-10 SMART
RRM 133 206 5.66e-14 SMART
RRM 222 295 1.15e-5 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 324 339 N/A INTRINSIC
low complexity region 343 351 N/A INTRINSIC
low complexity region 360 396 N/A INTRINSIC
low complexity region 419 454 N/A INTRINSIC
low complexity region 460 474 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 637 643 N/A INTRINSIC
low complexity region 675 699 N/A INTRINSIC
low complexity region 713 722 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135674
Predicted Effect probably damaging
Transcript: ENSMUST00000217359
AA Change: V75A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced long term potentiation and depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Raver1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Raver1 APN 9 21079240 missense probably damaging 1.00
IGL02863:Raver1 APN 9 21075971 missense probably damaging 0.98
IGL03128:Raver1 APN 9 21080742 missense probably damaging 1.00
R0265:Raver1 UTSW 9 21075659 missense probably benign 0.43
R1017:Raver1 UTSW 9 21079590 splice site probably benign
R3177:Raver1 UTSW 9 21079277 missense possibly damaging 0.90
R3277:Raver1 UTSW 9 21079277 missense possibly damaging 0.90
R4092:Raver1 UTSW 9 21081272 missense probably damaging 0.99
R4463:Raver1 UTSW 9 21091827 missense probably benign 0.01
R5302:Raver1 UTSW 9 21075381 missense probably damaging 1.00
R6021:Raver1 UTSW 9 21076622 missense probably damaging 1.00
R7065:Raver1 UTSW 9 21090294 missense probably benign 0.00
R7833:Raver1 UTSW 9 21081314 missense probably benign 0.11
R8480:Raver1 UTSW 9 21090280 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AACAAGGATCTGCTTCCTCTG -3'
(R):5'- AATCAGACAAGTTGGGCAGC -3'

Sequencing Primer
(F):5'- AGGATCTGCTTCCTCTGACACAAC -3'
(R):5'- AGCCTCCTTGAAGGTGTGCAG -3'
Posted On2016-11-08