Mutagenetix > Incidental Mutations

Incidental Mutation 'R5652:Kansl1'

441506

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

043298-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104338166 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 870 (R870C)

Ref Sequence

ENSEMBL: ENSMUSP00000102585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018556
AA Change: R807C

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: R807C

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

probably damaging
Transcript: ENSMUST00000106971
AA Change: R870C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: R870C

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106972
AA Change: R870C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: R870C

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106977
AA Change: R807C

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: R807C

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	G	9: 22,424,490	T135A	probably benign	Het
Abcc4	T	C	14: 118,618,927	I334V	probably benign	Het
Adamts5	C	T	16: 85,899,268	A334T	probably damaging	Het
Adcy4	G	C	14: 55,773,443	F672L	probably benign	Het
Adgrl1	A	G	8: 83,929,815	Y254C	probably damaging	Het
Adnp2	A	G	18: 80,130,850	S115P	probably damaging	Het
Aox1	A	T	1: 58,095,197	S1110C	probably damaging	Het
Arhgap44	G	T	11: 65,024,238	N401K	probably damaging	Het
Atp23	A	T	10: 126,899,625	N63K	possibly damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr2	T	C	3: 108,396,735	D2364G	probably null	Het
Celsr3	G	A	9: 108,838,472	D2116N	probably benign	Het
Cenpf	A	G	1: 189,657,082	S1518P	probably damaging	Het
Clcn3	C	A	8: 60,919,353	V758L	possibly damaging	Het
Ctsf	T	C	19: 4,858,477	L288P	probably damaging	Het
Cwh43	A	G	5: 73,418,141	T334A	probably damaging	Het
Cyp3a57	A	T	5: 145,349,325		probably null	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dennd1a	A	G	2: 37,801,126	I260T	probably benign	Het
Dgkh	T	C	14: 78,627,761	H47R	probably damaging	Het
Dync1h1	G	A	12: 110,665,988	V4514I	possibly damaging	Het
Dync2h1	A	T	9: 7,116,638	M66K	probably benign	Het
Fam186a	T	G	15: 99,945,372	Y997S	possibly damaging	Het
Fam8a1	T	A	13: 46,674,338	L334H	probably damaging	Het
Fat4	C	T	3: 39,002,968	T4271I	probably damaging	Het
Fdxacb1	T	A	9: 50,768,405	L41Q	probably damaging	Het
Fgfr2	C	T	7: 130,261,863	V18M	probably damaging	Het
Gpa33	A	C	1: 166,165,145		probably null	Het
Gpr1	A	G	1: 63,183,467	V203A	probably benign	Het
Gpr107	A	G	2: 31,185,589	I371V	probably benign	Het
Hectd2	T	C	19: 36,604,320	V420A	probably damaging	Het
Hist1h1t	A	G	13: 23,696,236	K124R	probably benign	Het
Iglc3	A	G	16: 19,065,670		probably benign	Het
Igtp	A	G	11: 58,206,629	T209A	probably benign	Het
Itgb7	T	A	15: 102,216,203	N793I	possibly damaging	Het
Kcnh6	C	T	11: 106,008,985	R27C	probably damaging	Het
Kif2b	T	A	11: 91,575,830	E542D	possibly damaging	Het
Klhl24	C	A	16: 20,120,247	Y517*	probably null	Het
Klhl25	A	G	7: 75,866,147	D267G	probably benign	Het
Krr1	C	A	10: 111,977,383	F195L	possibly damaging	Het
Lsr	C	T	7: 30,959,031	G95D	probably damaging	Het
Med15	A	T	16: 17,655,191	I504N	probably damaging	Het
Mug1	A	G	6: 121,840,181	R70G	probably benign	Het
Mypn	T	A	10: 63,135,801	Q820L	probably damaging	Het
Nlrp4f	A	T	13: 65,182,989	H863Q	probably benign	Het
Nudt9	G	A	5: 104,059,780	V213M	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr828	A	G	9: 18,815,626	S223P	probably damaging	Het
Olfr891	T	C	9: 38,180,815	T3A	probably benign	Het
Olfr987	T	A	2: 85,331,373	N175I	probably damaging	Het
Orc2	A	G	1: 58,466,072	F475L	probably damaging	Het
Oxa1l	T	A	14: 54,366,832	L183*	probably null	Het
Pcdh20	T	C	14: 88,467,324	T847A	probably damaging	Het
Pcdha6	G	A	18: 36,968,836		probably null	Het
Pip5k1a	T	C	3: 95,067,439	N376S	probably benign	Het
Pkd1l1	T	C	11: 8,909,889	E573G	probably benign	Het
Pkp1	T	A	1: 135,882,597		probably null	Het
Pum1	T	C	4: 130,764,127	I643T	possibly damaging	Het
Rapgef3	A	G	15: 97,758,437	S328P	probably benign	Het
Raver1	A	G	9: 21,090,312	V75A	probably damaging	Het
Rbm28	T	C	6: 29,135,409	E511G	probably damaging	Het
Satb1	T	A	17: 51,742,795	T544S	probably damaging	Het
Sdcbp2	T	C	2: 151,589,215	V248A	probably benign	Het
Sema7a	A	G	9: 57,960,659	D506G	probably damaging	Het
Sept8	A	G	11: 53,537,217	E286G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,422,812	I660V	probably damaging	Het
Stk38l	G	T	6: 146,773,328	D364Y	possibly damaging	Het
Sycp2	T	C	2: 178,358,705		probably null	Het
Tbc1d31	T	A	15: 57,951,666	S580T	probably damaging	Het
Tcerg1l	G	A	7: 138,280,046	R305C	probably damaging	Het
Tek	T	A	4: 94,855,324	Y859N	probably damaging	Het
Tjp1	A	T	7: 65,312,443		probably null	Het
Tmem132d	A	T	5: 127,784,795	I754N	possibly damaging	Het
Togaram1	G	A	12: 65,016,650	V1580I	probably benign	Het
Troap	A	G	15: 99,082,264	T442A	probably benign	Het
Ttn	A	T	2: 76,881,753		probably benign	Het
Twnk	T	A	19: 45,007,293	V55E	possibly damaging	Het
Uggt1	A	T	1: 36,216,153	Y225*	probably null	Het
Vmn2r109	A	G	17: 20,540,519	*859Q	probably null	Het
Vmn2r17	A	T	5: 109,429,564	I494L	probably benign	Het
Vmn2r88	T	C	14: 51,418,572	V746A	probably damaging	Het
Yae1d1	A	G	13: 17,991,706	L57P	probably damaging	Het
Zfp26	G	A	9: 20,437,841	R476*	probably null	Het
Zmynd8	T	A	2: 165,807,698	Q816L	probably damaging	Het
Zswim8	A	T	14: 20,713,427	H414L	possibly damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGGACCATCATGCCTGTC -3'
(R):5'- CAAGGACCTGTGTGTATGGTC -3'

Sequencing Primer
(F):5'- GGTCCTGAGTTCAAATCCCAG -3'
(R):5'- ACCTGTGTGTATGGTCATTCTATC -3'

Posted On

2016-11-08