Incidental Mutation 'R5652:Hist1h1t'
ID441511
Institutional Source Beutler Lab
Gene Symbol Hist1h1t
Ensembl Gene ENSMUSG00000036211
Gene Namehistone cluster 1, H1t
SynonymsH1ft
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23695814-23696725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23696236 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 124 (K124R)
Ref Sequence ENSEMBL: ENSMUSP00000037304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018246] [ENSMUST00000041052] [ENSMUST00000102967]
Predicted Effect probably benign
Transcript: ENSMUST00000018246
SMART Domains Protein: ENSMUSP00000018246
Gene: ENSMUSG00000018102

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041052
AA Change: K124R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037304
Gene: ENSMUSG00000036211
AA Change: K124R

DomainStartEndE-ValueType
H15 37 102 5.15e-21 SMART
low complexity region 111 135 N/A INTRINSIC
low complexity region 142 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102967
SMART Domains Protein: ENSMUSP00000100032
Gene: ENSMUSG00000060678

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice develop normally and exhibit normal testicular morphology, spermatogenesis and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl24 C A 16: 20,120,247 Y517* probably null Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Hist1h1t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Hist1h1t APN 13 23696049 missense probably damaging 0.98
FR4304:Hist1h1t UTSW 13 23695920 unclassified probably benign
FR4342:Hist1h1t UTSW 13 23695913 unclassified probably benign
FR4548:Hist1h1t UTSW 13 23695920 unclassified probably benign
R0167:Hist1h1t UTSW 13 23695903 missense probably benign 0.02
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0238:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0564:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0726:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R0827:Hist1h1t UTSW 13 23696221 missense probably benign 0.01
R0972:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1128:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1129:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R1130:Hist1h1t UTSW 13 23696324 missense possibly damaging 0.92
R5827:Hist1h1t UTSW 13 23696202 missense possibly damaging 0.91
R6538:Hist1h1t UTSW 13 23695921 missense probably benign 0.06
R7729:Hist1h1t UTSW 13 23696472 missense possibly damaging 0.93
R7774:Hist1h1t UTSW 13 23696200 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCCAAGCTGATTCCTGAGGC -3'
(R):5'- GCTTTTACGTTGCTGCACG -3'

Sequencing Primer
(F):5'- TTGCTGCCCTGAAGAAAGC -3'
(R):5'- GTTGCTGCACGCCCTTG -3'
Posted On2016-11-08