Incidental Mutation 'R5652:Klhl24'
ID441527
Institutional Source Beutler Lab
Gene Symbol Klhl24
Ensembl Gene ENSMUSG00000062901
Gene Namekelch-like 24
Synonyms
MMRRC Submission 043298-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5652 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20097542-20129221 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 20120247 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 517 (Y517*)
Ref Sequence ENSEMBL: ENSMUSP00000023509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023509]
Predicted Effect probably null
Transcript: ENSMUST00000023509
AA Change: Y517*
SMART Domains Protein: ENSMUSP00000023509
Gene: ENSMUSG00000062901
AA Change: Y517*

DomainStartEndE-ValueType
BTB 66 163 3.49e-29 SMART
BACK 168 270 1.53e-38 SMART
Kelch 314 363 8.21e-2 SMART
Kelch 364 407 6.04e-3 SMART
Kelch 408 454 5.71e-13 SMART
Kelch 455 502 1.51e-3 SMART
Kelch 503 544 9.19e-1 SMART
Kelch 545 592 2.43e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin ligase substrate receptor and is regulated by autoubiquitination. Variations in the translation initiation codon of this gene have been found, which result in an N-terminally truncated but more stable protein due to loss of the autoubiquitination function. The more stable mutant protein causes an increased ubiquitin and degradation of keratin 14, which leads to skin fragility and the potentially life-threatening disease epidermolysis bullosa. The encoded protein is also involved in the regulation of kainate receptors. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik A G 9: 22,424,490 T135A probably benign Het
Abcc4 T C 14: 118,618,927 I334V probably benign Het
Adamts5 C T 16: 85,899,268 A334T probably damaging Het
Adcy4 G C 14: 55,773,443 F672L probably benign Het
Adgrl1 A G 8: 83,929,815 Y254C probably damaging Het
Adnp2 A G 18: 80,130,850 S115P probably damaging Het
Aox1 A T 1: 58,095,197 S1110C probably damaging Het
Arhgap44 G T 11: 65,024,238 N401K probably damaging Het
Atp23 A T 10: 126,899,625 N63K possibly damaging Het
Atp8b1 G C 18: 64,531,382 I1238M probably benign Het
Ccdc38 A T 10: 93,555,586 probably null Het
Celsr2 T C 3: 108,396,735 D2364G probably null Het
Celsr3 G A 9: 108,838,472 D2116N probably benign Het
Cenpf A G 1: 189,657,082 S1518P probably damaging Het
Clcn3 C A 8: 60,919,353 V758L possibly damaging Het
Ctsf T C 19: 4,858,477 L288P probably damaging Het
Cwh43 A G 5: 73,418,141 T334A probably damaging Het
Cyp3a57 A T 5: 145,349,325 probably null Het
Ddr1 C T 17: 35,686,508 A531T probably benign Het
Dennd1a A G 2: 37,801,126 I260T probably benign Het
Dgkh T C 14: 78,627,761 H47R probably damaging Het
Dync1h1 G A 12: 110,665,988 V4514I possibly damaging Het
Dync2h1 A T 9: 7,116,638 M66K probably benign Het
Fam186a T G 15: 99,945,372 Y997S possibly damaging Het
Fam8a1 T A 13: 46,674,338 L334H probably damaging Het
Fat4 C T 3: 39,002,968 T4271I probably damaging Het
Fdxacb1 T A 9: 50,768,405 L41Q probably damaging Het
Fgfr2 C T 7: 130,261,863 V18M probably damaging Het
Gpa33 A C 1: 166,165,145 probably null Het
Gpr1 A G 1: 63,183,467 V203A probably benign Het
Gpr107 A G 2: 31,185,589 I371V probably benign Het
Hectd2 T C 19: 36,604,320 V420A probably damaging Het
Hist1h1t A G 13: 23,696,236 K124R probably benign Het
Iglc3 A G 16: 19,065,670 probably benign Het
Igtp A G 11: 58,206,629 T209A probably benign Het
Itgb7 T A 15: 102,216,203 N793I possibly damaging Het
Kansl1 G A 11: 104,338,166 R870C probably damaging Het
Kcnh6 C T 11: 106,008,985 R27C probably damaging Het
Kif2b T A 11: 91,575,830 E542D possibly damaging Het
Klhl25 A G 7: 75,866,147 D267G probably benign Het
Krr1 C A 10: 111,977,383 F195L possibly damaging Het
Lsr C T 7: 30,959,031 G95D probably damaging Het
Med15 A T 16: 17,655,191 I504N probably damaging Het
Mug1 A G 6: 121,840,181 R70G probably benign Het
Mypn T A 10: 63,135,801 Q820L probably damaging Het
Nlrp4f A T 13: 65,182,989 H863Q probably benign Het
Nudt9 G A 5: 104,059,780 V213M probably benign Het
Olfr177 A G 16: 58,872,484 L222P probably damaging Het
Olfr828 A G 9: 18,815,626 S223P probably damaging Het
Olfr891 T C 9: 38,180,815 T3A probably benign Het
Olfr987 T A 2: 85,331,373 N175I probably damaging Het
Orc2 A G 1: 58,466,072 F475L probably damaging Het
Oxa1l T A 14: 54,366,832 L183* probably null Het
Pcdh20 T C 14: 88,467,324 T847A probably damaging Het
Pcdha6 G A 18: 36,968,836 probably null Het
Pip5k1a T C 3: 95,067,439 N376S probably benign Het
Pkd1l1 T C 11: 8,909,889 E573G probably benign Het
Pkp1 T A 1: 135,882,597 probably null Het
Pum1 T C 4: 130,764,127 I643T possibly damaging Het
Rapgef3 A G 15: 97,758,437 S328P probably benign Het
Raver1 A G 9: 21,090,312 V75A probably damaging Het
Rbm28 T C 6: 29,135,409 E511G probably damaging Het
Satb1 T A 17: 51,742,795 T544S probably damaging Het
Sdcbp2 T C 2: 151,589,215 V248A probably benign Het
Sema7a A G 9: 57,960,659 D506G probably damaging Het
Sept8 A G 11: 53,537,217 E286G probably damaging Het
Sh3pxd2b A G 11: 32,422,812 I660V probably damaging Het
Stk38l G T 6: 146,773,328 D364Y possibly damaging Het
Sycp2 T C 2: 178,358,705 probably null Het
Tbc1d31 T A 15: 57,951,666 S580T probably damaging Het
Tcerg1l G A 7: 138,280,046 R305C probably damaging Het
Tek T A 4: 94,855,324 Y859N probably damaging Het
Tjp1 A T 7: 65,312,443 probably null Het
Tmem132d A T 5: 127,784,795 I754N possibly damaging Het
Togaram1 G A 12: 65,016,650 V1580I probably benign Het
Troap A G 15: 99,082,264 T442A probably benign Het
Ttn A T 2: 76,881,753 probably benign Het
Twnk T A 19: 45,007,293 V55E possibly damaging Het
Uggt1 A T 1: 36,216,153 Y225* probably null Het
Vmn2r109 A G 17: 20,540,519 *859Q probably null Het
Vmn2r17 A T 5: 109,429,564 I494L probably benign Het
Vmn2r88 T C 14: 51,418,572 V746A probably damaging Het
Yae1d1 A G 13: 17,991,706 L57P probably damaging Het
Zfp26 G A 9: 20,437,841 R476* probably null Het
Zmynd8 T A 2: 165,807,698 Q816L probably damaging Het
Zswim8 A T 14: 20,713,427 H414L possibly damaging Het
Other mutations in Klhl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Klhl24 APN 16 20122967 missense possibly damaging 0.78
IGL02419:Klhl24 APN 16 20107368 nonsense probably null
IGL02504:Klhl24 APN 16 20115943 nonsense probably null
IGL02799:Klhl24 UTSW 16 20114581 missense probably damaging 1.00
PIT4585001:Klhl24 UTSW 16 20106888 missense probably benign
R1512:Klhl24 UTSW 16 20122936 missense probably damaging 1.00
R1658:Klhl24 UTSW 16 20107092 nonsense probably null
R2076:Klhl24 UTSW 16 20117878 missense probably damaging 0.98
R2504:Klhl24 UTSW 16 20120167 missense probably benign 0.00
R4084:Klhl24 UTSW 16 20114562 missense probably damaging 0.98
R4299:Klhl24 UTSW 16 20107004 missense probably damaging 1.00
R4624:Klhl24 UTSW 16 20120123 missense probably damaging 1.00
R4780:Klhl24 UTSW 16 20106958 missense probably damaging 0.99
R5827:Klhl24 UTSW 16 20120121 nonsense probably null
R6363:Klhl24 UTSW 16 20120183 missense possibly damaging 0.52
R6734:Klhl24 UTSW 16 20107529 missense probably damaging 1.00
R7069:Klhl24 UTSW 16 20107481 missense probably benign 0.06
R7361:Klhl24 UTSW 16 20118000 missense probably benign
R7482:Klhl24 UTSW 16 20114655 missense possibly damaging 0.48
R7894:Klhl24 UTSW 16 20123000 missense probably damaging 1.00
R8229:Klhl24 UTSW 16 20114571 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGACCAAGAAGCAAGAATTTTCC -3'
(R):5'- ATGAGGCTCTGGACCCAATC -3'

Sequencing Primer
(F):5'- CCAAGAAGCAAGAATTTTCCTAATAC -3'
(R):5'- GCTCTGGACCCAATCTCAGC -3'
Posted On2016-11-08