Mutagenetix > Incidental Mutations

Incidental Mutation 'R5652:Adamts5'

441529

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

043298-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R5652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85899268 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 334 (A334T)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023611
AA Change: A334T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: A334T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	G	9: 22,424,490	T135A	probably benign	Het
Abcc4	T	C	14: 118,618,927	I334V	probably benign	Het
Adcy4	G	C	14: 55,773,443	F672L	probably benign	Het
Adgrl1	A	G	8: 83,929,815	Y254C	probably damaging	Het
Adnp2	A	G	18: 80,130,850	S115P	probably damaging	Het
Aox1	A	T	1: 58,095,197	S1110C	probably damaging	Het
Arhgap44	G	T	11: 65,024,238	N401K	probably damaging	Het
Atp23	A	T	10: 126,899,625	N63K	possibly damaging	Het
Atp8b1	G	C	18: 64,531,382	I1238M	probably benign	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr2	T	C	3: 108,396,735	D2364G	probably null	Het
Celsr3	G	A	9: 108,838,472	D2116N	probably benign	Het
Cenpf	A	G	1: 189,657,082	S1518P	probably damaging	Het
Clcn3	C	A	8: 60,919,353	V758L	possibly damaging	Het
Ctsf	T	C	19: 4,858,477	L288P	probably damaging	Het
Cwh43	A	G	5: 73,418,141	T334A	probably damaging	Het
Cyp3a57	A	T	5: 145,349,325		probably null	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dennd1a	A	G	2: 37,801,126	I260T	probably benign	Het
Dgkh	T	C	14: 78,627,761	H47R	probably damaging	Het
Dync1h1	G	A	12: 110,665,988	V4514I	possibly damaging	Het
Dync2h1	A	T	9: 7,116,638	M66K	probably benign	Het
Fam186a	T	G	15: 99,945,372	Y997S	possibly damaging	Het
Fam8a1	T	A	13: 46,674,338	L334H	probably damaging	Het
Fat4	C	T	3: 39,002,968	T4271I	probably damaging	Het
Fdxacb1	T	A	9: 50,768,405	L41Q	probably damaging	Het
Fgfr2	C	T	7: 130,261,863	V18M	probably damaging	Het
Gpa33	A	C	1: 166,165,145		probably null	Het
Gpr1	A	G	1: 63,183,467	V203A	probably benign	Het
Gpr107	A	G	2: 31,185,589	I371V	probably benign	Het
Hectd2	T	C	19: 36,604,320	V420A	probably damaging	Het
Hist1h1t	A	G	13: 23,696,236	K124R	probably benign	Het
Iglc3	A	G	16: 19,065,670		probably benign	Het
Igtp	A	G	11: 58,206,629	T209A	probably benign	Het
Itgb7	T	A	15: 102,216,203	N793I	possibly damaging	Het
Kansl1	G	A	11: 104,338,166	R870C	probably damaging	Het
Kcnh6	C	T	11: 106,008,985	R27C	probably damaging	Het
Kif2b	T	A	11: 91,575,830	E542D	possibly damaging	Het
Klhl24	C	A	16: 20,120,247	Y517*	probably null	Het
Klhl25	A	G	7: 75,866,147	D267G	probably benign	Het
Krr1	C	A	10: 111,977,383	F195L	possibly damaging	Het
Lsr	C	T	7: 30,959,031	G95D	probably damaging	Het
Med15	A	T	16: 17,655,191	I504N	probably damaging	Het
Mug1	A	G	6: 121,840,181	R70G	probably benign	Het
Mypn	T	A	10: 63,135,801	Q820L	probably damaging	Het
Nlrp4f	A	T	13: 65,182,989	H863Q	probably benign	Het
Nudt9	G	A	5: 104,059,780	V213M	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr828	A	G	9: 18,815,626	S223P	probably damaging	Het
Olfr891	T	C	9: 38,180,815	T3A	probably benign	Het
Olfr987	T	A	2: 85,331,373	N175I	probably damaging	Het
Orc2	A	G	1: 58,466,072	F475L	probably damaging	Het
Oxa1l	T	A	14: 54,366,832	L183*	probably null	Het
Pcdh20	T	C	14: 88,467,324	T847A	probably damaging	Het
Pcdha6	G	A	18: 36,968,836		probably null	Het
Pip5k1a	T	C	3: 95,067,439	N376S	probably benign	Het
Pkd1l1	T	C	11: 8,909,889	E573G	probably benign	Het
Pkp1	T	A	1: 135,882,597		probably null	Het
Pum1	T	C	4: 130,764,127	I643T	possibly damaging	Het
Rapgef3	A	G	15: 97,758,437	S328P	probably benign	Het
Raver1	A	G	9: 21,090,312	V75A	probably damaging	Het
Rbm28	T	C	6: 29,135,409	E511G	probably damaging	Het
Satb1	T	A	17: 51,742,795	T544S	probably damaging	Het
Sdcbp2	T	C	2: 151,589,215	V248A	probably benign	Het
Sema7a	A	G	9: 57,960,659	D506G	probably damaging	Het
Sept8	A	G	11: 53,537,217	E286G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,422,812	I660V	probably damaging	Het
Stk38l	G	T	6: 146,773,328	D364Y	possibly damaging	Het
Sycp2	T	C	2: 178,358,705		probably null	Het
Tbc1d31	T	A	15: 57,951,666	S580T	probably damaging	Het
Tcerg1l	G	A	7: 138,280,046	R305C	probably damaging	Het
Tek	T	A	4: 94,855,324	Y859N	probably damaging	Het
Tjp1	A	T	7: 65,312,443		probably null	Het
Tmem132d	A	T	5: 127,784,795	I754N	possibly damaging	Het
Togaram1	G	A	12: 65,016,650	V1580I	probably benign	Het
Troap	A	G	15: 99,082,264	T442A	probably benign	Het
Ttn	A	T	2: 76,881,753		probably benign	Het
Twnk	T	A	19: 45,007,293	V55E	possibly damaging	Het
Uggt1	A	T	1: 36,216,153	Y225*	probably null	Het
Vmn2r109	A	G	17: 20,540,519	*859Q	probably null	Het
Vmn2r17	A	T	5: 109,429,564	I494L	probably benign	Het
Vmn2r88	T	C	14: 51,418,572	V746A	probably damaging	Het
Yae1d1	A	G	13: 17,991,706	L57P	probably damaging	Het
Zfp26	G	A	9: 20,437,841	R476*	probably null	Het
Zmynd8	T	A	2: 165,807,698	Q816L	probably damaging	Het
Zswim8	A	T	14: 20,713,427	H414L	possibly damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably null
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGTTTGCATGCAAGATG -3'
(R):5'- GTCCATGGCCAGGATGTATG -3'

Sequencing Primer
(F):5'- TCCTTTATGGGAGAAGCAGAGCC -3'
(R):5'- GCCAGGATGTATGGGCGG -3'

Posted On

2016-11-08