Mutagenetix > Incidental Mutations

Incidental Mutation 'R5652:Atp8b1'

441534

Institutional Source

Beutler Lab

Gene Symbol

Atp8b1

Ensembl Gene

ENSMUSG00000039529

Gene Name

ATPase, class I, type 8B, member 1

Synonyms

FIC1, Ic

MMRRC Submission

043298-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64528979-64661000 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 64531382 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1238 (I1238M)

Ref Sequence

ENSEMBL: ENSMUSP00000025482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025482]

AlphaFold

Q148W0

Predicted Effect

probably benign
Transcript: ENSMUST00000025482
AA Change: I1238M

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: I1238M

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	65	144	5.3e-29	PFAM
Pfam:E1-E2_ATPase	146	413	6e-11	PFAM
Pfam:HAD	451	902	2.4e-21	PFAM
Pfam:Cation_ATPase	532	632	1e-12	PFAM
Pfam:PhoLip_ATPase_C	919	1173	7.3e-82	PFAM
low complexity region	1193	1207	N/A	INTRINSIC
low complexity region	1221	1232	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530077C05Rik	A	G	9: 22,424,490	T135A	probably benign	Het
Abcc4	T	C	14: 118,618,927	I334V	probably benign	Het
Adamts5	C	T	16: 85,899,268	A334T	probably damaging	Het
Adcy4	G	C	14: 55,773,443	F672L	probably benign	Het
Adgrl1	A	G	8: 83,929,815	Y254C	probably damaging	Het
Adnp2	A	G	18: 80,130,850	S115P	probably damaging	Het
Aox1	A	T	1: 58,095,197	S1110C	probably damaging	Het
Arhgap44	G	T	11: 65,024,238	N401K	probably damaging	Het
Atp23	A	T	10: 126,899,625	N63K	possibly damaging	Het
Ccdc38	A	T	10: 93,555,586		probably null	Het
Celsr2	T	C	3: 108,396,735	D2364G	probably null	Het
Celsr3	G	A	9: 108,838,472	D2116N	probably benign	Het
Cenpf	A	G	1: 189,657,082	S1518P	probably damaging	Het
Clcn3	C	A	8: 60,919,353	V758L	possibly damaging	Het
Ctsf	T	C	19: 4,858,477	L288P	probably damaging	Het
Cwh43	A	G	5: 73,418,141	T334A	probably damaging	Het
Cyp3a57	A	T	5: 145,349,325		probably null	Het
Ddr1	C	T	17: 35,686,508	A531T	probably benign	Het
Dennd1a	A	G	2: 37,801,126	I260T	probably benign	Het
Dgkh	T	C	14: 78,627,761	H47R	probably damaging	Het
Dync1h1	G	A	12: 110,665,988	V4514I	possibly damaging	Het
Dync2h1	A	T	9: 7,116,638	M66K	probably benign	Het
Fam186a	T	G	15: 99,945,372	Y997S	possibly damaging	Het
Fam8a1	T	A	13: 46,674,338	L334H	probably damaging	Het
Fat4	C	T	3: 39,002,968	T4271I	probably damaging	Het
Fdxacb1	T	A	9: 50,768,405	L41Q	probably damaging	Het
Fgfr2	C	T	7: 130,261,863	V18M	probably damaging	Het
Gpa33	A	C	1: 166,165,145		probably null	Het
Gpr1	A	G	1: 63,183,467	V203A	probably benign	Het
Gpr107	A	G	2: 31,185,589	I371V	probably benign	Het
Hectd2	T	C	19: 36,604,320	V420A	probably damaging	Het
Hist1h1t	A	G	13: 23,696,236	K124R	probably benign	Het
Iglc3	A	G	16: 19,065,670		probably benign	Het
Igtp	A	G	11: 58,206,629	T209A	probably benign	Het
Itgb7	T	A	15: 102,216,203	N793I	possibly damaging	Het
Kansl1	G	A	11: 104,338,166	R870C	probably damaging	Het
Kcnh6	C	T	11: 106,008,985	R27C	probably damaging	Het
Kif2b	T	A	11: 91,575,830	E542D	possibly damaging	Het
Klhl24	C	A	16: 20,120,247	Y517*	probably null	Het
Klhl25	A	G	7: 75,866,147	D267G	probably benign	Het
Krr1	C	A	10: 111,977,383	F195L	possibly damaging	Het
Lsr	C	T	7: 30,959,031	G95D	probably damaging	Het
Med15	A	T	16: 17,655,191	I504N	probably damaging	Het
Mug1	A	G	6: 121,840,181	R70G	probably benign	Het
Mypn	T	A	10: 63,135,801	Q820L	probably damaging	Het
Nlrp4f	A	T	13: 65,182,989	H863Q	probably benign	Het
Nudt9	G	A	5: 104,059,780	V213M	probably benign	Het
Olfr177	A	G	16: 58,872,484	L222P	probably damaging	Het
Olfr828	A	G	9: 18,815,626	S223P	probably damaging	Het
Olfr891	T	C	9: 38,180,815	T3A	probably benign	Het
Olfr987	T	A	2: 85,331,373	N175I	probably damaging	Het
Orc2	A	G	1: 58,466,072	F475L	probably damaging	Het
Oxa1l	T	A	14: 54,366,832	L183*	probably null	Het
Pcdh20	T	C	14: 88,467,324	T847A	probably damaging	Het
Pcdha6	G	A	18: 36,968,836		probably null	Het
Pip5k1a	T	C	3: 95,067,439	N376S	probably benign	Het
Pkd1l1	T	C	11: 8,909,889	E573G	probably benign	Het
Pkp1	T	A	1: 135,882,597		probably null	Het
Pum1	T	C	4: 130,764,127	I643T	possibly damaging	Het
Rapgef3	A	G	15: 97,758,437	S328P	probably benign	Het
Raver1	A	G	9: 21,090,312	V75A	probably damaging	Het
Rbm28	T	C	6: 29,135,409	E511G	probably damaging	Het
Satb1	T	A	17: 51,742,795	T544S	probably damaging	Het
Sdcbp2	T	C	2: 151,589,215	V248A	probably benign	Het
Sema7a	A	G	9: 57,960,659	D506G	probably damaging	Het
Sept8	A	G	11: 53,537,217	E286G	probably damaging	Het
Sh3pxd2b	A	G	11: 32,422,812	I660V	probably damaging	Het
Stk38l	G	T	6: 146,773,328	D364Y	possibly damaging	Het
Sycp2	T	C	2: 178,358,705		probably null	Het
Tbc1d31	T	A	15: 57,951,666	S580T	probably damaging	Het
Tcerg1l	G	A	7: 138,280,046	R305C	probably damaging	Het
Tek	T	A	4: 94,855,324	Y859N	probably damaging	Het
Tjp1	A	T	7: 65,312,443		probably null	Het
Tmem132d	A	T	5: 127,784,795	I754N	possibly damaging	Het
Togaram1	G	A	12: 65,016,650	V1580I	probably benign	Het
Troap	A	G	15: 99,082,264	T442A	probably benign	Het
Ttn	A	T	2: 76,881,753		probably benign	Het
Twnk	T	A	19: 45,007,293	V55E	possibly damaging	Het
Uggt1	A	T	1: 36,216,153	Y225*	probably null	Het
Vmn2r109	A	G	17: 20,540,519	*859Q	probably null	Het
Vmn2r17	A	T	5: 109,429,564	I494L	probably benign	Het
Vmn2r88	T	C	14: 51,418,572	V746A	probably damaging	Het
Yae1d1	A	G	13: 17,991,706	L57P	probably damaging	Het
Zfp26	G	A	9: 20,437,841	R476*	probably null	Het
Zmynd8	T	A	2: 165,807,698	Q816L	probably damaging	Het
Zswim8	A	T	14: 20,713,427	H414L	possibly damaging	Het

Other mutations in Atp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Atp8b1	APN	18	64564430	missense	probably benign	0.23
IGL00907:Atp8b1	APN	18	64561705	missense	possibly damaging	0.95
IGL00962:Atp8b1	APN	18	64531444	missense	probably damaging	1.00
IGL01433:Atp8b1	APN	18	64573519	missense	probably benign	0.00
IGL01525:Atp8b1	APN	18	64539252	nonsense	probably null
IGL01645:Atp8b1	APN	18	64546113	missense	probably benign	0.06
IGL02008:Atp8b1	APN	18	64538695	splice site	probably benign
IGL02227:Atp8b1	APN	18	64562190	missense	probably benign
IGL02231:Atp8b1	APN	18	64550384	missense	possibly damaging	0.94
IGL02326:Atp8b1	APN	18	64538583	missense	probably damaging	0.99
IGL02562:Atp8b1	APN	18	64581986	missense	probably benign
IGL02929:Atp8b1	APN	18	64561662	missense	possibly damaging	0.63
enchilada	UTSW	18	64545989	critical splice donor site	probably null
PIT4520001:Atp8b1	UTSW	18	64568180	missense	probably benign	0.34
PIT4696001:Atp8b1	UTSW	18	64539270	missense	possibly damaging	0.93
R0144:Atp8b1	UTSW	18	64571374	splice site	probably benign
R0193:Atp8b1	UTSW	18	64561636	missense	probably benign
R0277:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0308:Atp8b1	UTSW	18	64545244	nonsense	probably null
R0323:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0403:Atp8b1	UTSW	18	64540310	missense	probably damaging	1.00
R0601:Atp8b1	UTSW	18	64571653	splice site	probably null
R0614:Atp8b1	UTSW	18	64533587	splice site	probably benign
R0883:Atp8b1	UTSW	18	64564541	missense	probably benign	0.44
R1077:Atp8b1	UTSW	18	64573262	nonsense	probably null
R1292:Atp8b1	UTSW	18	64571021	missense	probably damaging	0.99
R1494:Atp8b1	UTSW	18	64564526	missense	probably damaging	1.00
R1522:Atp8b1	UTSW	18	64550432	missense	probably benign	0.00
R1534:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1535:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1536:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1537:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1650:Atp8b1	UTSW	18	64571549	splice site	probably benign
R1772:Atp8b1	UTSW	18	64573492	missense	possibly damaging	0.88
R2016:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2017:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2043:Atp8b1	UTSW	18	64605200	missense	possibly damaging	0.94
R2223:Atp8b1	UTSW	18	64564357	missense	possibly damaging	0.88
R3052:Atp8b1	UTSW	18	64553108	missense	probably benign	0.04
R3694:Atp8b1	UTSW	18	64533721	missense	possibly damaging	0.81
R3738:Atp8b1	UTSW	18	64533729	splice site	probably benign
R4211:Atp8b1	UTSW	18	64553047	missense	probably damaging	1.00
R4362:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R4560:Atp8b1	UTSW	18	64556879	nonsense	probably null
R4560:Atp8b1	UTSW	18	64568247	missense	probably benign	0.11
R4562:Atp8b1	UTSW	18	64556891	missense	probably damaging	1.00
R4615:Atp8b1	UTSW	18	64553099	missense	probably null
R4676:Atp8b1	UTSW	18	64538678	missense	probably benign	0.01
R4738:Atp8b1	UTSW	18	64545180	missense	probably benign	0.31
R4774:Atp8b1	UTSW	18	64533659	missense	possibly damaging	0.49
R4808:Atp8b1	UTSW	18	64561711	missense	probably benign	0.01
R4868:Atp8b1	UTSW	18	64551866	missense	probably damaging	1.00
R5162:Atp8b1	UTSW	18	64561662	missense	possibly damaging	0.63
R5289:Atp8b1	UTSW	18	64546087	missense	possibly damaging	0.51
R5328:Atp8b1	UTSW	18	64531391	missense	probably benign	0.00
R5400:Atp8b1	UTSW	18	64545989	critical splice donor site	probably null
R5587:Atp8b1	UTSW	18	64539210	missense	probably damaging	1.00
R5623:Atp8b1	UTSW	18	64546094	missense	possibly damaging	0.85
R5651:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5653:Atp8b1	UTSW	18	64545197	missense	probably damaging	1.00
R5667:Atp8b1	UTSW	18	64581923	missense	probably damaging	1.00
R5689:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R6008:Atp8b1	UTSW	18	64577616	missense	probably damaging	1.00
R6315:Atp8b1	UTSW	18	64531479	missense	probably damaging	0.97
R6759:Atp8b1	UTSW	18	64546090	missense	probably benign	0.00
R6850:Atp8b1	UTSW	18	64556852	missense	possibly damaging	0.94
R7255:Atp8b1	UTSW	18	64556868	missense	probably damaging	1.00
R7606:Atp8b1	UTSW	18	64555115	missense	probably damaging	1.00
R7635:Atp8b1	UTSW	18	64573305	missense	possibly damaging	0.59
R7639:Atp8b1	UTSW	18	64564543	missense	possibly damaging	0.91
R7698:Atp8b1	UTSW	18	64571022	missense	probably benign	0.03
R7727:Atp8b1	UTSW	18	64545275	missense	probably damaging	1.00
R7779:Atp8b1	UTSW	18	64541382	missense	probably damaging	1.00
R7785:Atp8b1	UTSW	18	64556850	missense	probably damaging	1.00
R7874:Atp8b1	UTSW	18	64571024	missense	probably benign	0.30
R7990:Atp8b1	UTSW	18	64538677	missense	possibly damaging	0.91
R8020:Atp8b1	UTSW	18	64546013	missense	probably damaging	1.00
R8161:Atp8b1	UTSW	18	64556987	missense	probably damaging	1.00
R9007:Atp8b1	UTSW	18	64551860	missense	probably benign	0.40
R9064:Atp8b1	UTSW	18	64564420	missense	probably benign	0.12
R9266:Atp8b1	UTSW	18	64571037	missense	probably benign	0.08
R9266:Atp8b1	UTSW	18	64577457	missense	possibly damaging	0.70
R9326:Atp8b1	UTSW	18	64573273	missense	probably damaging	1.00
X0025:Atp8b1	UTSW	18	64571405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGCTTTGCGATTGCTTAAC -3'
(R):5'- TCCAGAAGCATCGAAAGCG -3'

Sequencing Primer
(F):5'- ACAGCACAATCCTAGAAGTTTATTG -3'
(R):5'- TCGAAAGCGATTGAAGGCTG -3'

Posted On

2016-11-08