Incidental Mutation 'R5621:Slc11a1'
ID441543
Institutional Source Beutler Lab
Gene Symbol Slc11a1
Ensembl Gene ENSMUSG00000026177
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonymshost resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1
MMRRC Submission 043279-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5621 (G1)
Quality Score188
Status Validated
Chromosome1
Chromosomal Location74375195-74386062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74380906 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 191 (G191D)
Ref Sequence ENSEMBL: ENSMUSP00000139455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]
Predicted Effect probably damaging
Transcript: ENSMUST00000027368
AA Change: G232D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177
AA Change: G232D

DomainStartEndE-ValueType
Pfam:Nramp 75 460 1.5e-119 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155865
Predicted Effect probably damaging
Transcript: ENSMUST00000187516
AA Change: G191D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177
AA Change: G191D

DomainStartEndE-ValueType
Pfam:Nramp 46 419 1.4e-109 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T G 17: 84,695,993 L417R probably damaging Het
Als2 A G 1: 59,191,890 V854A probably benign Het
Bbox1 C T 2: 110,292,523 W140* probably null Het
Ccdc28a A T 10: 18,216,268 N110K probably benign Het
Chrna6 C T 8: 27,407,040 E270K probably damaging Het
Cilp A G 9: 65,278,791 K723E possibly damaging Het
Ciz1 C A 2: 32,371,741 A455E probably damaging Het
Csmd3 T G 15: 48,313,978 H388P possibly damaging Het
Dnajc8 A G 4: 132,553,252 probably benign Het
Dnase1 G T 16: 4,039,118 C164F probably benign Het
Dync2h1 A T 9: 7,120,909 I2126K possibly damaging Het
Epha4 G T 1: 77,515,049 probably benign Het
Fer1l6 T C 15: 58,558,326 C201R probably damaging Het
Fgf8 T C 19: 45,742,382 Y68C probably benign Het
Gabrb1 A T 5: 72,108,728 I243F probably damaging Het
Gm13762 T C 2: 88,973,466 I142V probably benign Het
Gm9774 G A 3: 92,428,357 A346V probably damaging Het
Gpam A C 19: 55,079,260 S484A probably damaging Het
Hectd2 T A 19: 36,618,751 N745K probably damaging Het
Hspa13 T C 16: 75,766,763 probably benign Het
Ints2 A G 11: 86,242,947 F426L probably benign Het
Ism1 A G 2: 139,678,721 T18A probably damaging Het
Itih2 T A 2: 10,102,805 Q650L probably benign Het
Jmjd4 T C 11: 59,450,393 F50S probably damaging Het
Kif5b T C 18: 6,226,883 N125S probably benign Het
Lonp1 G C 17: 56,620,263 A330G probably benign Het
Lrfn1 A G 7: 28,466,836 I552V probably damaging Het
Mcph1 A G 8: 18,632,170 E441G probably damaging Het
Mdn1 T A 4: 32,716,371 H2144Q possibly damaging Het
Mms19 A G 19: 41,966,313 S56P probably benign Het
Mrgprb3 A G 7: 48,643,368 I145T probably benign Het
Myh11 G A 16: 14,244,855 T287I probably damaging Het
Npas2 A G 1: 39,359,713 T730A probably benign Het
Olfr1229 G A 2: 89,282,353 P281L probably damaging Het
Pcdhgb1 A G 18: 37,682,169 E571G possibly damaging Het
Pcx T A 19: 4,619,167 V731E possibly damaging Het
Pgm1 T A 5: 64,112,038 Y489* probably null Het
Rrp12 T C 19: 41,880,417 T541A probably benign Het
Ryr3 C T 2: 112,900,984 W660* probably null Het
Sertad2 T A 11: 20,648,061 F86I possibly damaging Het
Slc22a22 G T 15: 57,259,151 F143L probably benign Het
Slc22a28 C T 19: 8,071,011 V424I probably benign Het
Slc7a11 T G 3: 50,438,875 K106N probably damaging Het
Smgc A T 15: 91,844,420 D121V probably damaging Het
Sphk1 C T 11: 116,536,366 probably benign Het
Spock3 A T 8: 63,144,006 T118S probably benign Het
Stk17b G T 1: 53,771,784 S54* probably null Het
Sycp2 A G 2: 178,381,918 I435T probably benign Het
Tm2d3 G T 7: 65,701,618 D207Y probably damaging Het
Top2b A T 14: 16,387,280 N123Y probably damaging Het
Unc80 A G 1: 66,638,043 T2044A possibly damaging Het
Usp6nl A G 2: 6,440,432 S407G probably benign Het
Vmn1r195 G A 13: 22,278,389 V10I probably benign Het
Zfp292 C T 4: 34,811,703 R447H probably damaging Het
Other mutations in Slc11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Slc11a1 APN 1 74381898 splice site probably null
IGL00813:Slc11a1 APN 1 74383480 missense probably benign 0.03
IGL00970:Slc11a1 APN 1 74380662 missense probably damaging 1.00
IGL01017:Slc11a1 APN 1 74379796 missense probably damaging 1.00
IGL01646:Slc11a1 APN 1 74384740 missense probably damaging 0.99
IGL01941:Slc11a1 APN 1 74377179 missense probably damaging 1.00
IGL01996:Slc11a1 APN 1 74376806 missense possibly damaging 0.93
IGL02580:Slc11a1 APN 1 74380259 missense probably damaging 0.99
IGL02586:Slc11a1 APN 1 74385132 splice site probably benign
IGL02961:Slc11a1 APN 1 74377173 missense probably damaging 1.00
R1813:Slc11a1 UTSW 1 74375772 missense probably benign
R1896:Slc11a1 UTSW 1 74375772 missense probably benign
R2219:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2220:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2416:Slc11a1 UTSW 1 74383644 missense probably damaging 0.96
R2432:Slc11a1 UTSW 1 74383751 splice site probably benign
R3893:Slc11a1 UTSW 1 74384706 missense probably damaging 1.00
R4450:Slc11a1 UTSW 1 74385535 utr 3 prime probably benign
R4638:Slc11a1 UTSW 1 74375278 start gained probably benign
R4782:Slc11a1 UTSW 1 74384088 missense probably damaging 0.98
R5068:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5069:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5070:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5215:Slc11a1 UTSW 1 74383777 intron probably benign
R5333:Slc11a1 UTSW 1 74384145 missense probably damaging 1.00
R5613:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5622:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5950:Slc11a1 UTSW 1 74377176 missense probably benign 0.40
R6239:Slc11a1 UTSW 1 74384115 missense possibly damaging 0.82
R6776:Slc11a1 UTSW 1 74384085 missense probably damaging 1.00
R7199:Slc11a1 UTSW 1 74383671 missense possibly damaging 0.83
R7356:Slc11a1 UTSW 1 74385489 missense probably benign
R8142:Slc11a1 UTSW 1 74385259 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCATGGGTAGCCGAAG -3'
(R):5'- GAGTCCAGGCTCAGAAATGG -3'

Sequencing Primer
(F):5'- GGGTCTAGAGAAACAGCCCTTAGC -3'
(R):5'- CAGGCTCAGAAATGGGATCCTC -3'
Posted On2016-11-08